LFY, EU500524.1-LFY (gene) Crataegus sp. 2001_29A

Gene Overview
NameLFY
Unique NameEU500524.1-LFY
Typegene
OrganismCrataegus sp. 2001_29A ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus sp. 2001_29Agene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEU500524.1-LFY.m1Crataegus sp. 2001_29AmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU500524.1
Alignments
Feature NameTypeLocationAnalysis
EU500524 region EU500524:1..417+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU500524.1-LFY ID=EU500524.1-LFY|Name=LFY|organism=Crataegus sp. 2001_29A|type=gene|length=417bp
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgat
tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca
gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt
ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat
taacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgtgta
ccacatacataacgatctggtacaaggtattaacggaagttggaacaaaa
tgtataatttcgttttgcatttgtttactctttacattatatatgcaggt
gacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca
acaaacccaaaatgagc
back to top

gene from alignment at EU500524:1..417+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500524.1-LFY ID=EU500524.1-LFY|Name=LFY|organism=Crataegus sp. 2001_29A|type=gene|length=417bp|location=Sequence derived from alignment at EU500524:1..417+ (Crataegus sp. 2001_29A)
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat taacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgtgta ccacatacataacgatctggtacaaggtattaacggaagttggaacaaaa tgtataatttcgttttgcatttgtttactctttacattatatatgcaggt gacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatca acaaacccaaaatgagc
back to top