HMG1, EU780785.1-HMG1.m1 (mRNA) Pyrus pyrifolia

Transcript Overview
Unique NameEU780785.1-HMG1.m1
OrganismPyrus pyrifolia ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
HMG1HMG1Pyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU780785.1-HMG1.m1-cds1EU780785.1-HMG1.m1-cds1Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
HMG1EU780785.1-HMG1.p1Pyrus pyrifoliapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU780785 region EU780785:1..1830+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Product3-hydroxy-3-methylglutaryl coenzyme A reductase 1
Genbank notePphmgr1
The following sequences are available for this feature:

mRNA sequence

>EU780785.1-HMG1.m1 ID=EU780785.1-HMG1.m1|Name=HMG1|organism=Pyrus pyrifolia|type=mRNA|length=1830bp
back to top

protein sequence of HMG1

>EU780785.1-HMG1.p1 ID=EU780785.1-HMG1.p1|Name=HMG1|organism=Pyrus pyrifolia|type=polypeptide|length=609bp
back to top

mRNA from alignment at EU780785:1..1830+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU780785.1-HMG1.m1 ID=EU780785.1-HMG1.m1|Name=HMG1|organism=Pyrus pyrifolia|type=mRNA|length=1830bp|location=Sequence derived from alignment at EU780785:1..1830+ (Pyrus pyrifolia)
atggacgttcgccggcgatctacgatggatacacctgccaccaaggcccg ctctgggccgatgaaggtgaatgtcgtggaccaagaggaagaggtcggtg ccgtcggcgctaaggcctccgatgccctgccgctgcctttgtacctcact aatggggtcttcttcaccctgtttttctccgttgtctactttcttcttac tgcttggcgcgagaagatcaggacttctactcctctccacgtcgttaccc tttctgagatcgtcgcgattctctcgttggtcgcttctgtgatttatctt ctggggttcttcgggatcgagtttgttcagtcgttcattctccggccttc caatgatgtttgttcggcccgatgtgaggaggaagatgatgagcgattta tcttggaagaagatagtcgtaatggaccttgtggggccgctactgaccgc ggttcaattctcccaacaccacctgttgcagaagttgccccaatagctgt tgcacagcaagcttctgataaggaagtcatcctatcgacacctggcgatt tcattacacaaccagtgtcggaggaagatgaggagatgatcaaatccgtc ctcgcgggaacaattccttcgtactctctggagtcaaaactcggtgattg caagagagctgctgcgattcggagggaggcgcttcagaggatcacaggga agtctctggaagggctaccattggagggatttgattatgaatccattctg ggtcagtgctgtgagatgccagttggttatgtgcagatacccgttggaat agctgggcctttgttgcttgatgggagagagtattcggtgccaccgatgg caactactgagggttgcttggttgccagcaccaaccgtggctgcaaagct atcaacttgtccggcggagccaccagtgtgttgctgagagatgggatgac cagagcgccttgtgtgaggttcaactctgctaagagagctgccgagttga agttctacttggaagaccccaacaattatgacaccttgtccgcggttttc aacaggtcaagcagattcggtaggcttcagacaattaagtgtgccattgc tgggaagaacttgtacatgagattcacctgcagcaccggtgatgctatgg ggatgaacatggtctccaaaggtgcgcaaaacgttttggatttcctccag aacgacttccctgacatggatgtgattggaatttccggcaactactgctc tgacaagaagcccgctgcggtgaactggatcgaaggtcgtggaaaatcgg tggtctgtgaggctgtgatcaagggtgatgtggtgcagaaggtgttgaaa accaatgtggcgtccctgtgcgagcttaacatgctcaagaaccttactgg gtctgcaatggctggagccctcggtggattcaacgcacatgccagcaaca tcgtctctgccatctacatcgctaccggccaagacccagctcagaatgtg gagagttctcactgcattaccatgatggaacccatcaatgatgggcagga ccttcacgtgtctgtcaccatgccttcaactgaggttggtactgttggag gtgggacccaacttgcatctcaatcagcttgtctgaaccttcttggagtg aagggtgctaacagggaggcaccaggatctaatgcaagattgttggccac tgttgtggctggttctgttcttgctggagagctttctctcatgtctgcta tctcagctggacagcttgtgaatagtcacatgaaatacaacagatcaagc aaagatgtctcagctgttgcgtccgcttaa
back to top

Coding sequence (CDS) from alignment at EU780785:1..1830+

>EU780785.1-HMG1.m1 ID=EU780785.1-HMG1.m1|Name=HMG1|organism=Pyrus pyrifolia|type=CDS|length=1830bp|location=Sequence derived from alignment at EU780785:1..1830+ (Pyrus pyrifolia)
back to top