ANR, DQ664193.1-ANR.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameDQ664193.1-ANR.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRDQ664193.1-ANRFragaria x ananassagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ANRANRFragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ664193.1-ANR.m1-cds1DQ664193.1-ANR.m1-cds1Fragaria x ananassaCDS
DQ664193.1-ANR.m1-cds2DQ664193.1-ANR.m1-cds2Fragaria x ananassaCDS
DQ664193.1-ANR.m1-cds3DQ664193.1-ANR.m1-cds3Fragaria x ananassaCDS
DQ664193.1-ANR.m1-cds4DQ664193.1-ANR.m1-cds4Fragaria x ananassaCDS
DQ664193.1-ANR.m1-cds5DQ664193.1-ANR.m1-cds5Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ANRDQ664193.1-ANR.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
DQ664193 region DQ664193:1..1684+ NCBI Rosaceae gene and mRNA sequences
LG5 chromosome LG5:66912..68686+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productanthocyanidin reductase
The following sequences are available for this feature:

mRNA sequence

>DQ664193.1-ANR.m1 ID=DQ664193.1-ANR.m1|Name=ANR|organism=Fragaria x ananassa|type=mRNA|length=1020bp
back to top

protein sequence of ANR

>DQ664193.1-ANR.p1 ID=DQ664193.1-ANR.p1|Name=ANR|organism=Fragaria x ananassa|type=polypeptide|length=339bp
back to top

mRNA from alignment at DQ664193:1..1684+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ664193.1-ANR.m1 ID=DQ664193.1-ANR.m1|Name=ANR|organism=Fragaria x ananassa|type=mRNA|length=1684bp|location=Sequence derived from alignment at DQ664193:1..1684+ (Fragaria x ananassa)
atggccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcgg cggcaccggcttcgtgacgtctcagctgatcaagctcttgctagagaagg gctatgccgtcagaaccactgttagagacccaggtcagaactatatcccc tagcttcttcagacctatattttggttttaccctatttttgcttagcttg gaaaatggataagtactaggtataaagttttgaaatggatgcataatata gttgtcagtcttatcacctagaagcttcattatgagctaggtgaggaggg cattagtgaaatagttgaggatctctaggaacgtactggggttaatctct ctgtaaaattttagtaatgagagtaaaatttctgagtttagtgtgtatat taattagctggtgtgaactgtgtattaatgtgtacatttttggcccagat aatctgaagaagatctcccacctaacagcactacaagagttgggagagct aacaatatttcgtggggatttaaccgatgaagggagctttgatgctgcta tagcaggttctgatcttgttttccatgtagccacaccagtccactttggc tcgccggatccagagaacgacatgatcaagccaggagtccaaggagtact aaacgttatgaaatcatgtgtgaaagcaaaaacagttaagcgagtcgttt tgacatcatcagcagctgcagtaactgtcaatactcttagtggaacaggc ttgatcgccgacgaaaatgattggtctgatgttgagttcttgacaactgc caagccacctacttgggtaatcaccaaattgtttcagtttcaagagtatt tgacttgtgtaattgatgctagacaaaaggcctacattgaaataaatgaa ccaggtgacaaaggttttttttccctcaaatttgcagggatatcctgttt caaaggtactagctgagaagacagcatggaaatttgctgaagaaaacaac attgatctcatcactgtgatcccttctctcatggctggtgcttctctcac tccagatatccccagcagtataggcctcgccacgtctttaattacaggta tcaaaccatgccacaagctagaatatgttgtccattgctttaacttagtt acttaaggccttacagcttgaatgaaaagtaatatgcgctgcggccttcc aatgatcctttttgactctttcaggaaatgagttcctcataaatggcttg aaaggcatgcaaatgctatcaggttccatatccattacacatgtggagga tgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtc ggtacatatgctgtgctgaaaatagtagtgttcctgaggttgcaaagttc ctcagcaaaagatatcccgactacaaagtcccgactgagtaagttttcta ttcaaagggaatagccctttaagactatggctgaacttacagaaggcttg aagtgcatttcattttgttataatccttttgcaatgcaggtttggagatt ttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggag gggttcactttcaagtacgggattgaagacatatatgaccaaactgtgga gtacttgaaacttaagggggtgctgcagaactag
back to top

Coding sequence (CDS) from alignment at DQ664193:1..1684+

>DQ664193.1-ANR.m1 ID=DQ664193.1-ANR.m1|Name=ANR|organism=Fragaria x ananassa|type=CDS|length=1020bp|location=Sequence derived from alignment at DQ664193:1..1684+ (Fragaria x ananassa)
back to top