SDH7, AY244813.1-SDH7.m1 (mRNA) Malus x domestica

Transcript Overview
Unique NameAY244813.1-SDH7.m1
OrganismMalus x domestica (Apple)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SDH7SDH7Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY244813.1-SDH7.m1-cds1AY244813.1-SDH7.m1-cds1Malus x domesticaCDS
AY244813.1-SDH7.m1-cds2AY244813.1-SDH7.m1-cds2Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
SDH7AY244813.1-SDH7.p1Malus x domesticapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AY244813 region AY244813:1..1085+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductNAD-dependent sorbitol dehydrogenase 7
The following sequences are available for this feature:

mRNA sequence

>AY244813.1-SDH7.m1 ID=AY244813.1-SDH7.m1|Name=SDH7|organism=Malus x domestica|type=mRNA|length=966bp
back to top

protein sequence of SDH7

>AY244813.1-SDH7.p1 ID=AY244813.1-SDH7.p1|Name=SDH7|organism=Malus x domestica|type=polypeptide|length=321bp
back to top

mRNA from alignment at AY244813:1..1085+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY244813.1-SDH7.m1 ID=AY244813.1-SDH7.m1|Name=SDH7|organism=Malus x domestica|type=mRNA|length=1085bp|location=Sequence derived from alignment at AY244813:1..1085+ (Malus x domestica)
agatcctacctttcaagctccccgctattggtatttacttctctcccttc ttttaaattcatcgttattttttttcggtttttggttttcaccgttgtag tgatgctaacatgctgctcccctgttctcttgggatttcttaattttagg acccaatgatgtccggattcggattaaggcggttggtatttgtggaagcg atgttcactacctcaggaccatgaaatgtgcggattttgaggttaaagaa ccgatggtgatcggacatgagtgtgctgggatcgtagacaaagttgggag cgaggtgaagcatctggtgcctggtgaccgggtggcggttgagcccggta tcagttgctcacggcgtcagcagtgcaaaggagggcagtacaatctttgc cccgacatgaagtttttcgccaccccaccggttcatggttcattggcgaa tcagattgtgcaccccgcggatctgtgctttaaattgccggaaaatgtga gcttggaagaaggggcaatgtgtgagcccttgagtgttggggttcacgct tgtcggcgagccaatgttggtcccgaaacaactgttctgatcgtcggcgc agggccgatcgggctggtttccgtgctggctgctcgtgctttcggagcac caagaattgtcatcgtagatatggatgacaggcgtttagccatggcaaag tctctcggcgccgatggcacggtcaaagtttcgataaaaatggaggattt agatgacgaagttgccaagattaaagaagctatgggatccgaagttgatg tgaccttcgactgtgttggcttcaacaaaaccatgtctacgggcctcaat gccactcgtcctggcggcaaagtctgccttgtcggaatgggacacggggt gatgacagtccctctcactccggctgctgccagggaggttgacgtggttg gagtttttcgttacaagaacacatggccgctttgccttgagtttttgaga agcgggaagatcgacgtgaagccgcttattacccaccggtttggttttac cgagaaggaggtggaagaagcaagcttggaattct
back to top

Coding sequence (CDS) from alignment at AY244813:1..1085+

>AY244813.1-SDH7.m1 ID=AY244813.1-SDH7.m1|Name=SDH7|organism=Malus x domestica|type=CDS|length=966bp|location=Sequence derived from alignment at AY244813:1..1085+ (Malus x domestica)
back to top