GAPDH, EU315077.1-GAPDH (gene) Rosa gymnocarpa

Gene Overview
Unique NameEU315077.1-GAPDH
OrganismRosa gymnocarpa ()
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa gymnocarpagene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
GAPDHEU315077.1-GAPDH.m1Rosa gymnocarpamRNA

Cross References
External references for this gene
Feature NameTypeLocationAnalysis
EU315077 region EU315077:1..749+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
The following sequences are available for this feature:

gene sequence

>EU315077.1-GAPDH ID=EU315077.1-GAPDH|Name=GAPDH|organism=Rosa gymnocarpa|type=gene|length=749bp
back to top

gene from alignment at EU315077:1..749+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU315077.1-GAPDH ID=EU315077.1-GAPDH|Name=GAPDH|organism=Rosa gymnocarpa|type=gene|length=749bp|location=Sequence derived from alignment at EU315077:1..749+ (Rosa gymnocarpa)
gtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactag atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccaga agactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcc tcattcaacatcattcccagcagcactggagctgccaaggtattttcaat gttctttgtgccactgcttcagtattgttgatacacttttaagttacatg tcagtgatacttcatctgtaacagctttattaatccttgattttggaata tctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccg gaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtg tcatgacattacaatgcatgtcttggttctaatcttttatctttaattct gtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttac accgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaat gaatattagtcatttaatggttggagtactatgtacagaataaaccatct atgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top