LFY, EU050739.1-LFY (gene) Prunus subcordata

Gene Overview
NameLFY
Unique NameEU050739.1-LFY
Typegene
OrganismPrunus subcordata ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPrunus subcordatagene


Cross References
External references for this gene
DatabaseAccession
nuccoreEU050739.1
Alignments
Feature NameTypeLocationAnalysis
EU050739 region EU050739:1..666+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU050739.1-LFY ID=EU050739.1-LFY|Name=LFY|organism=Prunus subcordata|type=gene|length=666bp
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctg
atttatactgtggtaaatagtaaatactaatagtaacttgtcgcatggac
tatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacaacatcaat
ataatgtttgacctaactctggaccgggtctgaatttttcattgattatg
tgacgttcacaagaaattttttgaaaaaaaaaaaaaaaagggggtttgtg
aataagatcatattttaatcctacgttggtctgaatttgatctgctttgt
tagaaatatatagtgattccaataatgatgttaatatggcgtagaattgg
ataattggttagcttagtaaaggtagagattttcacactcatgttttgtt
cgtttgcactccgctctttgttatattttgatgatctatcatctgctttt
atttcccaaggtagaaaaacaatagaaaagtgcaaacagataaaatcgga
gtgtgaaagtcgccacccttaggtatccgatatttgtaaataatgaatga
tttatcttgtgaccatgacaagtgaattgttgtattttggttgtgtgaac
atgaattattgtgcag
back to top