LFY, EU050737.1-LFY (gene) Prunus pumila var. pumila

Gene Overview
NameLFY
Unique NameEU050737.1-LFY
Typegene
OrganismPrunus pumila var. pumila ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPrunus pumila var. pumilagene


Cross References
External references for this gene
DatabaseAccession
nuccoreEU050737.1
Alignments
Feature NameTypeLocationAnalysis
EU050737 region EU050737:1..674+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU050737.1-LFY ID=EU050737.1-LFY|Name=LFY|organism=Prunus pumila var. pumila|type=gene|length=674bp
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgstg
atttatactgtggtaaatagtaaatactaatagtaacttgtcgcatggac
tatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggcccgacagtttcaattggaaaggcctgctgacagcatcaat
ataatgtttgagctaactctggaccgggtctgaatttttcattgattatg
tggcagagtaagttcacaagaaattttttgaaaaaaaaaaaaaaaaaaag
ggkttgtgaatgagatcatattttaatcctactttggtctaaatttgatc
tgctttgttagaaatatatagtgattccaataatgatgttaatatgacgt
agaattggataattggttagcttaataaaggtagagattttcacactyat
gttttgttcatttgcactccgctttttgttatattttgatgatctatcat
ctgcttttattttctaaggtagaacaacaatagaaaagtgcaaaccgata
aaatcggtgtgtgaaagtcgccacccttaagtatccaatatttataaata
atgaatgatttatcttgtgaccatgacaagtgaattgttgtattttagtt
gtgtgaacatgaattattgtgcag
back to top