LFY, EU050725.1-LFY (gene) Prunus maritima

Gene Overview
NameLFY
Unique NameEU050725.1-LFY
Typegene
OrganismPrunus maritima ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPrunus maritimagene


Cross References
External references for this gene
DatabaseAccession
nuccoreEU050725.1
Alignments
Feature NameTypeLocationAnalysis
EU050725 region EU050725:1..669+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU050725.1-LFY ID=EU050725.1-LFY|Name=LFY|organism=Prunus maritima|type=gene|length=669bp
gtacggagtttacccaacctcccgtcttcataacctaaatgcatacgctg
atttatactgtggtaaatagtaaatactaatagtaacttgtcgcatggac
tatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtggctcgacagtttcaattggaaacgcctgctgacagcatcaat
ataatgtttgagctaactctggaccgggtctgaatttttcattgattatg
tggcagagtaagttcacaagaaattttttgaaaaaaaaaaaagggggttt
gtgaataagatcatattttaatcctacgttggtctgaatttgatctgctt
tgttagaaatatatagtgattccaataatgatgttaatatgacgtagaat
tggataattggttagcttagtaaaggtagagattttcacactcatgtttt
gttcgtttgcactccgctctttgttgtattttgatgatctatcatcagct
tttatttcccaaggtagaaaaacaatagaaaagtgcaaaccgataaaatc
ggagtgtgaaagtcaccacccttaggtatccgatatttgtaaatcatgaa
tgatttatcttatgaccatgacaagtgaattgttgtattttggttgtgtg
aacatgaattattgtgcag
back to top