LFY, EU050722.1-LFY (gene) Prunus geniculata

Gene Overview
NameLFY
Unique NameEU050722.1-LFY
Typegene
OrganismPrunus geniculata ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPrunus geniculatagene


Cross References
External references for this gene
DatabaseAccession
nuccoreEU050722.1
Alignments
Feature NameTypeLocationAnalysis
EU050722 region EU050722:1..660+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU050722.1-LFY ID=EU050722.1-LFY|Name=LFY|organism=Prunus geniculata|type=gene|length=660bp
gtacggaatttacccaacctcccgtcttcataacctaaatgcatacgctg
atttattctgtggtaaatagtaaatactaatagtaacttgtcgcatggac
tatcatacctggtcaatgtggtcccatttccgcaagtacaaacaattaca
atctagtgggtcgacagtttcaattggaaacgcctgctgacaacatcaat
ataatgtttgagctaactctggaccgggtctgaatttttcattgattatg
tggcagagtaagttcacaataaattttttgaaaaaaaaaaagggggtttg
tgaataagatcatattttaatcctacgttggtctgaatttgatctgcttt
gttagaaatatatagtgattccaataatgatgttaatatgacgtagaatt
ggataatttggttagcttagtgattttcacactcatgttttgttcgtttg
cactccgctctttgytatattttgatgatctatcatctgcttttatttcc
caaggtagaaaaacaatagaaaagtgcaaacggataaaatcgaagtgtga
aagtcgccacccttaggtatccgatatttgtaaataatgaatgatttatc
ttgtgaccatgacaagtgaattgttgtattttggttgcgtggacatgaat
tattgtgcag
back to top