LFY, EF127080.1-LFY (gene) Aronia sp. EYYL-2006

Gene Overview
NameLFY
Unique NameEF127080.1-LFY
Typegene
OrganismAronia sp. EYYL-2006 ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYAronia sp. EYYL-2006gene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEF127080.1-LFY.m1Aronia sp. EYYL-2006mRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEF127080.1
Alignments
Feature NameTypeLocationAnalysis
EF127080 region EF127080:1..686+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EF127080.1-LFY ID=EF127080.1-LFY|Name=LFY|organism=Aronia sp. EYYL-2006|type=gene|length=686bp
atggtgacggagccgggggaggtggcgcgtggcaaaaagaatggcctcga
ttacctcttccatctctacgagcagtgccgcgatttcttgatccaggtcc
agaacatcgccaaggagcgcggtgaaaaatgtcccaccaaggtaccacgt
tttacccatctcccttttacttttacgtacgctgatttctactgtagaaa
ctaacagtaacttcatcgtgttagccattgatttgtgggcccatttcctg
tagtacaattaaaggctagtaggccgtaataaatttcaccacaaatctat
atcttttaatcgaactcaacataaatattaaattgaggggtgtcctcgaa
ttggaacaatttgcaatctacatgaactaaattagatgaaattaaacgca
ggtctttgtgaaaactacatggattaaaaacgtgtttcgggtgaatagct
cagtatttagtccaaatttgattctactagtgatttgagtccgttgattc
gattatgatgtaatcaaatacgtgttaagaaaaaatgtacgccattataa
tctgaccggatttaacaaaatgtataatttcgtttgcatttgtttactct
acacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaag
gcaggggcaagctacatcaacaagccaaagatgcga
back to top

gene from alignment at EF127080:1..686+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127080.1-LFY ID=EF127080.1-LFY|Name=LFY|organism=Aronia sp. EYYL-2006|type=gene|length=686bp|location=Sequence derived from alignment at EF127080:1..686+ (Aronia sp. EYYL-2006)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaatggcctcga ttacctcttccatctctacgagcagtgccgcgatttcttgatccaggtcc agaacatcgccaaggagcgcggtgaaaaatgtcccaccaaggtaccacgt tttacccatctcccttttacttttacgtacgctgatttctactgtagaaa ctaacagtaacttcatcgtgttagccattgatttgtgggcccatttcctg tagtacaattaaaggctagtaggccgtaataaatttcaccacaaatctat atcttttaatcgaactcaacataaatattaaattgaggggtgtcctcgaa ttggaacaatttgcaatctacatgaactaaattagatgaaattaaacgca ggtctttgtgaaaactacatggattaaaaacgtgtttcgggtgaatagct cagtatttagtccaaatttgattctactagtgatttgagtccgttgattc gattatgatgtaatcaaatacgtgttaagaaaaaatgtacgccattataa tctgaccggatttaacaaaatgtataatttcgtttgcatttgtttactct acacattatatatgcaggtgacaaaccaagtgtttaggtatgccaaaaag gcaggggcaagctacatcaacaagccaaagatgcga
back to top