LFY, EF127077.1-LFY (gene) Mespilus germanica

Gene Overview
NameLFY
Unique NameEF127077.1-LFY
Typegene
OrganismMespilus germanica ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYMespilus germanicagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEF127077.1-LFY.m1Mespilus germanicamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEF127077.1
Alignments
Feature NameTypeLocationAnalysis
EF127077 region EF127077:1..397+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EF127077.1-LFY ID=EF127077.1-LFY|Name=LFY|organism=Mespilus germanica|type=gene|length=397bp
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga
ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc
agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt
tttacccatctcccctcttacgtacgctgatttctactgtggcaattaat
taacagtaaaaattctaatattaaatggtcgcgtttgtaatggttttagt
tctatagtttccacatagttatggtttcgttcacgtattgcaagtcgcat
ttgtttactcattacattatatatgcaggtgacaaaccaagtgtttaggt
atgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top

gene from alignment at EF127077:1..397+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127077.1-LFY ID=EF127077.1-LFY|Name=LFY|organism=Mespilus germanica|type=gene|length=397bp|location=Sequence derived from alignment at EF127077:1..397+ (Mespilus germanica)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt tttacccatctcccctcttacgtacgctgatttctactgtggcaattaat taacagtaaaaattctaatattaaatggtcgcgtttgtaatggttttagt tctatagtttccacatagttatggtttcgttcacgtattgcaagtcgcat ttgtttactcattacattatatatgcaggtgacaaaccaagtgtttaggt atgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top