LFY, EF127073.1-LFY (gene) Crataegus songarica

Gene Overview
NameLFY
Unique NameEF127073.1-LFY
Typegene
OrganismCrataegus songarica ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus songaricagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEF127073.1-LFY.m1Crataegus songaricamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEF127073.1
Alignments
Feature NameTypeLocationAnalysis
EF127073 region EF127073:1..619+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EF127073.1-LFY ID=EF127073.1-LFY|Name=LFY|organism=Crataegus songarica|type=gene|length=619bp
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga
ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc
agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt
tttacccatctcccctctttacgtacgctgatttctactgtggcaattaa
ttaacagtaaaaattctaaygttagtcattgaaatcaacacaaatattaa
atggtcgcgtttgtaatggttttagttctatagtttccacatagttatag
tttcgttcatgtattgcaagtcgcatcgacataactcccgacaatttgca
aattgctgtaattcsaaggcacccgtcaaattttgttgaattcttgtatg
aagtccgtcaaatttaccatttcgtgtaccacatacataacgatctggta
caaggtattaacggaagttgaggtttagggatgtcctcragttggaacaa
aacgtacaatttcgttttgcatttgtttactctttacattatatatgcag
gtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacat
caacaagcccaagatgacc
back to top

gene from alignment at EF127073:1..619+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127073.1-LFY ID=EF127073.1-LFY|Name=LFY|organism=Crataegus songarica|type=gene|length=619bp|location=Sequence derived from alignment at EF127073:1..619+ (Crataegus songarica)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt tttacccatctcccctctttacgtacgctgatttctactgtggcaattaa ttaacagtaaaaattctaaygttagtcattgaaatcaacacaaatattaa atggtcgcgtttgtaatggttttagttctatagtttccacatagttatag tttcgttcatgtattgcaagtcgcatcgacataactcccgacaatttgca aattgctgtaattcsaaggcacccgtcaaattttgttgaattcttgtatg aagtccgtcaaatttaccatttcgtgtaccacatacataacgatctggta caaggtattaacggaagttgaggtttagggatgtcctcragttggaacaa aacgtacaatttcgttttgcatttgtttactctttacattatatatgcag gtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacat caacaagcccaagatgacc
back to top