LFY, EF127048.1-LFY (gene) Crataegus punctata

Gene Overview
NameLFY
Unique NameEF127048.1-LFY
Typegene
OrganismCrataegus punctata ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus punctatagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEF127048.1-LFY.m1Crataegus punctatamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEF127048.1
Alignments
Feature NameTypeLocationAnalysis
EF127048 region EF127048:1..418+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EF127048.1-LFY ID=EF127048.1-LFY|Name=LFY|organism=Crataegus punctata|type=gene|length=418bp
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga
ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc
agaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagt
tttacccatctcccctctttaagtacgctgatttctactgtggcaattaa
ttaacagtaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgt
accacatacataacgatctggtacaaggtattaacggaagttggaacaaa
atgtataatttcgttttgcatttgtttactatttacattatatatgcagg
tgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc
aacaagcccaaaatgcgc
back to top

gene from alignment at EF127048:1..418+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127048.1-LFY ID=EF127048.1-LFY|Name=LFY|organism=Crataegus punctata|type=gene|length=418bp|location=Sequence derived from alignment at EF127048:1..418+ (Crataegus punctata)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagt tttacccatctcccctctttaagtacgctgatttctactgtggcaattaa ttaacagtaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgt accacatacataacgatctggtacaaggtattaacggaagttggaacaaa atgtataatttcgttttgcatttgtttactatttacattatatatgcagg tgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc aacaagcccaaaatgcgc
back to top