LFY, EF127046.1-LFY (gene) Crataegus chlorosarca

Gene Overview
NameLFY
Unique NameEF127046.1-LFY
Typegene
OrganismCrataegus chlorosarca ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus chlorosarcagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYEF127046.1-LFY.m1Crataegus chlorosarcamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEF127046.1
Alignments
Feature NameTypeLocationAnalysis
EF127046 region EF127046:1..442+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EF127046.1-LFY ID=EF127046.1-LFY|Name=LFY|organism=Crataegus chlorosarca|type=gene|length=442bp
atggtgacggagccgggggatgtggcgcgtggcgaaaagaacggccttga
ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc
agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt
tttacccgtctcccctctttacgtacgctgatttctactgtggcaattaa
ttaacagaaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgt
accacatacataacgatctggtacaaggtattaacggaagttgaggttta
gggatgtcctcgagttggaacaaaatgtataatttccttttgcatttgtt
tactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgcc
aaaaaggcaggggcaagctacatcaacaaacccaaaatgcgc
back to top

gene from alignment at EF127046:1..442+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127046.1-LFY ID=EF127046.1-LFY|Name=LFY|organism=Crataegus chlorosarca|type=gene|length=442bp|location=Sequence derived from alignment at EF127046:1..442+ (Crataegus chlorosarca)
atggtgacggagccgggggatgtggcgcgtggcgaaaagaacggccttga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt tttacccgtctcccctctttacgtacgctgatttctactgtggcaattaa ttaacagaaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgt accacatacataacgatctggtacaaggtattaacggaagttgaggttta gggatgtcctcgagttggaacaaaatgtataatttccttttgcatttgtt tactctttacattatatatgcaggtgacaaaccaagtgtttaggtatgcc aaaaaggcaggggcaagctacatcaacaaacccaaaatgcgc
back to top