ACO, AF441282.1-ACO.m1 (mRNA) Rosa hybrid cultivar

Transcript Overview
Unique NameAF441282.1-ACO.m1
OrganismRosa hybrid cultivar ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACOACORosa hybrid cultivargene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF441282.1-ACO.m1-cds1AF441282.1-ACO.m1-cds1Rosa hybrid cultivarCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACOAF441282.1-ACO.p1Rosa hybrid cultivarpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF441282 region AF441282:1..831+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
Genbank noteACO
The following sequences are available for this feature:

mRNA sequence

>AF441282.1-ACO.m1 ID=AF441282.1-ACO.m1|Name=ACO|organism=Rosa hybrid cultivar|type=mRNA|length=831bp
back to top

protein sequence of ACO

>AF441282.1-ACO.p1 ID=AF441282.1-ACO.p1|Name=ACO|organism=Rosa hybrid cultivar|type=polypeptide|length=277bp
back to top

mRNA from alignment at AF441282:1..831+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF441282.1-ACO.m1 ID=AF441282.1-ACO.m1|Name=ACO|organism=Rosa hybrid cultivar|type=mRNA|length=831bp|location=Sequence derived from alignment at AF441282:1..831+ (Rosa hybrid cultivar)
gcttgtgaaaactggggttttttcgagttggtgaaccatgggatatccca tgagctgatggacaaggtagagaagctcacaaaggagcactacagaaagt gcgtggagcaaaggttcaaggaaatggtggcaagcaaaggcctcgaatct gtcaactctgaaatcgaagatttggactgggaaagcaccttcttcttgcg ccacctccccttctccaacatttcccaaatccccgatctcgacgaagatt acagggaggccatgaaggaatttgcagtggaactagagaaactggctgag aaactgttggacttgctgtgtgagaatctggggctggataagggttacct gaagaaggctttctatggatccgagggaccaaattttgggaccaaggtga gcaactaccctccatgccccaaaccggacctgatcaagggactccgggcc cacaccgacgccggtggcatcatcctactattccaagatgacaaggtcag cggcctccagctcctcaaggatgaccaatggattgatgtgccaccaatgc accactccattgtcatcaacttaggtgaccaacttgaggtgattactaat ggcaagtacaagagtgtgatgcaccgtgtgatagcgcaacctgatggaaa cagaatgtcgatagcctcgttctacaacccaggcaatgatgcttttatct ctccagcaccagcaatgcttgaaaaacagactgaggaatgcccaacttat ccaaaatttgtgtttgatgactacatgaagctctatgcaggcctcaaatt ccaagccaaggaaccgcggttcgaggcgatg
back to top

Coding sequence (CDS) from alignment at AF441282:1..831+

>AF441282.1-ACO.m1 ID=AF441282.1-ACO.m1|Name=ACO|organism=Rosa hybrid cultivar|type=CDS|length=831bp|location=Sequence derived from alignment at AF441282:1..831+ (Rosa hybrid cultivar)
back to top