GLU, AF435089.1-GLU.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameAF435089.1-GLU.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUAF435089.1-GLUPrunus persicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GLUGLUPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF435089.1-GLU.m1-cds1AF435089.1-GLU.m1-cds1Prunus persicaCDS
AF435089.1-GLU.m1-cds2AF435089.1-GLU.m1-cds2Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GLUAF435089.1-GLU.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF435089 region AF435089:1473..3181+ NCBI Rosaceae gene and mRNA sequences
scaffold_7 supercontig scaffold_7:8584001..8585698- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
The following sequences are available for this feature:

mRNA sequence

>AF435089.1-GLU.m1 ID=AF435089.1-GLU.m1|Name=GLU|organism=Prunus persica|type=mRNA|length=1032bp
back to top

protein sequence of GLU

>AF435089.1-GLU.p1 ID=AF435089.1-GLU.p1|Name=GLU|organism=Prunus persica|type=polypeptide|length=343bp
back to top

mRNA from alignment at AF435089:1473..3181+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF435089.1-GLU.m1 ID=AF435089.1-GLU.m1|Name=GLU|organism=Prunus persica|type=mRNA|length=1709bp|location=Sequence derived from alignment at AF435089:1473..3181+ (Prunus persica)
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgat agtatttctacttgggctgctgatggctagctttgaaacaacaggtatat atctctggcaagattcgtccctattttggcttggaaggctacatagtttt gatattcttacaaactttgaggctattaagggctaaaagggccgagctcg tatttgacaattatttatttatttttttactatagatctgtgggaactgt tgcctgatacttttcttttacacaattacttgatttttccaacgaacttc tgtgttgcttccatgtctgggtcagggtggatggaaacaatgtgcaaaac agaatttaatagcttctacttaaacttcattttcatgtgcaaggttattg ataagcgggggaagggaagaatgctgttgggttttactttttttcaattg aaaaattatttattatttattttgtccacgtgtgtacgaaattacaaaaa cacccatgtcacgtagtcaaaattaacaaatttttggacggagttgatgt tggggggcaaacaaggccaccaaaatacggtcaagcggggtaagtgagcc actttgaatttcagagagcagtgtgagatttgaccgtagtttcaagggac attggtgtaaataggccttgaatatattcatgatcattttagcaacaaat tatattgtataaatctagtgaacttttcaccaggatcataaaacctcatt ataatttcttcaatattgcaggagcccagattggtgtatgttatggaatg cttggagatcgtttaccacccccatcagaagttattgctctgtataagca aaataacatcagaaggatgcgactgtatgatccaaaccaggctgctctag cagcccttaaaggctcttatattgagctcatgctaggcgttccaaatgac aaccttcaaagcctagcctcaagccaggccaatgcaaatacttgggtcca aaacaatgtgagaaactatggcaatgtaagattcaaatacattgcggtag gaaatgaagtcaagccctcagactcctatgcacaatttcttgtcccggcc atgcaaaacattcagaacgcaatttctagtgctggtttgggaattaaagt ctccactgccgtagacactggagtgcttggaaattcctttcctccatcga agggagagttcaagtccgaatatggagcacttttgaaccccatcatccgc ttcctagtgaacaacagatcgccgttgctggttaatttgtacccgtattt cagctacagcagcaacactcacgacattcgtctagattatgctcttttca cagctccatcagttgtggtacaagatggccaacgtggctatcgtaatctt ttcgatgccattttggacgctgtttatgccgctcttgagaaggcgggcgg agggtctttggaaattgtcatatccgaaagtggttggccatcagctggtg gaacggcaacaacaattgataatgcaaggacttataatgcaaatctgatt caacatgtgaagggagggactccaaggaagcccggaagggccatagaaac ctacatctttgccatgtttgatgagaacagaaagaacccagagttggaga aacattgggggctgttttcaccaagcaaacagccgaaatacccaatcaat ttcaactga
back to top

Coding sequence (CDS) from alignment at AF435089:1473..3181+

>AF435089.1-GLU.m1 ID=AF435089.1-GLU.m1|Name=GLU|organism=Prunus persica|type=CDS|length=1032bp|location=Sequence derived from alignment at AF435089:1473..3181+ (Prunus persica)
back to top