GAPDH2, AF421493.1-GAPDH2.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameAF421493.1-GAPDH2.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDH2AF421493.1-GAPDH2Fragaria x ananassagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDH2GAPDH2Fragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF421493.1-GAPDH2.m1-cds1AF421493.1-GAPDH2.m1-cds1Fragaria x ananassaCDS
AF421493.1-GAPDH2.m1-cds2AF421493.1-GAPDH2.m1-cds2Fragaria x ananassaCDS
AF421493.1-GAPDH2.m1-cds3AF421493.1-GAPDH2.m1-cds3Fragaria x ananassaCDS
AF421493.1-GAPDH2.m1-cds4AF421493.1-GAPDH2.m1-cds4Fragaria x ananassaCDS
AF421493.1-GAPDH2.m1-cds5AF421493.1-GAPDH2.m1-cds5Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDH2AF421493.1-GAPDH2.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF421493 region AF421493:1..845+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productglyceraldehyde 3-phosphate dehydrogenase 2
The following sequences are available for this feature:

mRNA sequence

>AF421493.1-GAPDH2.m1 ID=AF421493.1-GAPDH2.m1|Name=GAPDH2|organism=Fragaria x ananassa|type=mRNA|length=399bp
back to top

protein sequence of GAPDH2

>AF421493.1-GAPDH2.p1 ID=AF421493.1-GAPDH2.p1|Name=GAPDH2|organism=Fragaria x ananassa|type=polypeptide|length=133bp
back to top

mRNA from alignment at AF421493:1..845+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF421493.1-GAPDH2.m1 ID=AF421493.1-GAPDH2.m1|Name=GAPDH2|organism=Fragaria x ananassa|type=mRNA|length=845bp|location=Sequence derived from alignment at AF421493:1..845+ (Fragaria x ananassa)
tccatcactggtgagttttcacttgtgacttgagatatatgaatgttgag atgctatatataaatctaatggaagttgattgtgtctttgtaattcagcc acccagaagactgttgatggaccatcagccaaggactggagaggtggacg tgctgcctcattcaacatcattcctagcagcactggagctgccaaggtat gttatgttctctggtgttgctgctagtttcagtatcacagatacatttcc aagtgatatttcattgttagctgctttattaatccgattcctgtttgatt gtcatgttcaggctgtcggaaaggttctgcctgctctcaatggcaagttg actggaatggccttccgtgtacccactgttgatgtttcagttgttgacct cactgtcagacttgagaagaaggccacctatgaccagatcaaggctgcta tcaagtaaggctcggaaaagtttgtcggctaaataagttgcaatcaagat gatataatgaatggtataatgcatgtcttgtttcccatgtttatgtctac tctgtctcaacagggaggggtctgagggaaagatgaagggtatcttgggt tacaccgaagatgatgttgtgtcaaccgacttcattggtgacaacaggta aattctattctgtttgggatttgactcaacaagttaaagccagagaacaa tctgtcatgtttggacggtgattatctatattgtagttgtgtaatatcgg ctttatctaattcaatatctggttctctcaggtcaagcatctttgatgcc aaggctggaattgcattgaacgagaactttgtcaaggttgtgtca
back to top

Coding sequence (CDS) from alignment at AF421493:1..845+

>AF421493.1-GAPDH2.m1 ID=AF421493.1-GAPDH2.m1|Name=GAPDH2|organism=Fragaria x ananassa|type=CDS|length=399bp|location=Sequence derived from alignment at AF421493:1..845+ (Fragaria x ananassa)
back to top