LFY, AF487196.1-LFY (gene) Neillia hanceana

Gene Overview
NameLFY
Unique NameAF487196.1-LFY
Typegene
OrganismNeillia hanceana ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYNeillia hanceanagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAF487196.1-LFY.m1Neillia hanceanamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF487196.1
Alignments
Feature NameTypeLocationAnalysis
AF487196 region AF487196:1..638+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF487196.1-LFY ID=AF487196.1-LFY|Name=LFY|organism=Neillia hanceana|type=gene|length=638bp
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtt
tttacaaacgctaatttctaccgtggtaaatacttcgtcatttacaacct
gatcgttgtgggcccatcgttggctagtggcccgcaattggagaggcatg
ctggcacgttcaatataaatgttcgaactataaatctaggaataattaat
agtttgttactaaattaggaactttgggttcatttacaaacacttttatt
aaaagcacaacaaaaaggaagtgcatctccaacaaccataaaaaatactt
ttagagtaaaaaatcacttttaattatttcaaccatgggtcaagaccaaa
tgttgatccactaataattaatcgtgttcttctctttcatagtaaaaaac
acttgcactattttgtaggataaaaatctagactcaattgttggtgcaga
cgacttctattgtgtacggtgaatgttttatgttttcttctataatttga
aatgttttttgtttttttttcctaacattaacaactgtcgtaagtactaa
ttgtgcattatgtataattggacggattaagcagcttacttattatatat
gcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top

gene from alignment at AF487196:1..638+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487196.1-LFY ID=AF487196.1-LFY|Name=LFY|organism=Neillia hanceana|type=gene|length=638bp|location=Sequence derived from alignment at AF487196:1..638+ (Neillia hanceana)
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtt tttacaaacgctaatttctaccgtggtaaatacttcgtcatttacaacct gatcgttgtgggcccatcgttggctagtggcccgcaattggagaggcatg ctggcacgttcaatataaatgttcgaactataaatctaggaataattaat agtttgttactaaattaggaactttgggttcatttacaaacacttttatt aaaagcacaacaaaaaggaagtgcatctccaacaaccataaaaaatactt ttagagtaaaaaatcacttttaattatttcaaccatgggtcaagaccaaa tgttgatccactaataattaatcgtgttcttctctttcatagtaaaaaac acttgcactattttgtaggataaaaatctagactcaattgttggtgcaga cgacttctattgtgtacggtgaatgttttatgttttcttctataatttga aatgttttttgtttttttttcctaacattaacaactgtcgtaagtactaa ttgtgcattatgtataattggacggattaagcagcttacttattatatat gcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top