LFY, AF487176.1-LFY (gene) Neillia affinis

Gene Overview
NameLFY
Unique NameAF487176.1-LFY
Typegene
OrganismNeillia affinis ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYNeillia affinisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAF487176.1-LFY.m1Neillia affinismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF487176.1
Alignments
Feature NameTypeLocationAnalysis
AF487176 region AF487176:1..678+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF487176.1-LFY ID=AF487176.1-LFY|Name=LFY|organism=Neillia affinis|type=gene|length=678bp
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtt
tttacaaacgctaatttctaccgcggtaaatacttcgtcatttacaacct
gctcgttgtgggcccatcgttggctagtgggccgcaattggagaagcatg
ctgacacgttcaatataaatgctcaaactaaatctaggagcccaagttca
caagaaataaaatcattaatagtgtgttgctaaattaggaactttgggtt
cgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaa
ggaagtgcatctccaacaaccataaaaaatacttttagagtacaaaatca
cttttaattatttcaaccatgggtcaagaccaaatgttgacccactaata
attaatcgtgttcttctctttcatagtaaaaaacacttgcactattttgt
aggataaaaatctagacacaattgttggtgcagagtgcggacgacttcta
ttgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttt
tgtttttttttctaacattaacaactgtcgtaagtactaattgtgcatta
tgtataattggacggattaagcagcttacttattatatatgcaggtgaca
aaccaggtgtttaggtatgccaaaaagg
back to top

gene from alignment at AF487176:1..678+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487176.1-LFY ID=AF487176.1-LFY|Name=LFY|organism=Neillia affinis|type=gene|length=678bp|location=Sequence derived from alignment at AF487176:1..678+ (Neillia affinis)
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtt tttacaaacgctaatttctaccgcggtaaatacttcgtcatttacaacct gctcgttgtgggcccatcgttggctagtgggccgcaattggagaagcatg ctgacacgttcaatataaatgctcaaactaaatctaggagcccaagttca caagaaataaaatcattaatagtgtgttgctaaattaggaactttgggtt cgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaa ggaagtgcatctccaacaaccataaaaaatacttttagagtacaaaatca cttttaattatttcaaccatgggtcaagaccaaatgttgacccactaata attaatcgtgttcttctctttcatagtaaaaaacacttgcactattttgt aggataaaaatctagacacaattgttggtgcagagtgcggacgacttcta ttgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttt tgtttttttttctaacattaacaactgtcgtaagtactaattgtgcatta tgtataattggacggattaagcagcttacttattatatatgcaggtgaca aaccaggtgtttaggtatgccaaaaagg
back to top