LFY, AF487173.1-LFY (gene) Physocarpus capitatus

Gene Overview
NameLFY
Unique NameAF487173.1-LFY
Typegene
OrganismPhysocarpus capitatus ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYPhysocarpus capitatusgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAF487173.1-LFY.m1Physocarpus capitatusmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF487173.1
Alignments
Feature NameTypeLocationAnalysis
AF487173 region AF487173:1..905+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF487173.1-LFY ID=AF487173.1-LFY|Name=LFY|organism=Physocarpus capitatus|type=gene|length=905bp
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat
attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac
ctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcc
tgctgacaccctcaatataaatgttttgagctagctgtaggagcccaaat
tcacaagaaatcaaaatctttaataggtttgttactaatttaggaacttt
gccacttagcactacggtctagtggtatttctcttcacttgtaagtcaga
ggtcttaggttcaagtctcggcaaatccattgtgtggcttagcctaattc
tcacacttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag
gaactttggattcctttggaattacttctatagaatacacttttacctat
aaatacttcttttactaaaagcacaacaaaagcactcgggagtgcgtctc
caagaaccataaaaatgcgttcattattttaaccaaacactatcagcagc
acttgtggatttttgaaagcacttttagccctgtaatataggctctaaat
attccaacatttatctaaatttggtttgactggccagatgttagacagtg
attgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaa
aagtctagacccaattgttagtgcattcgactattattatatccgatagg
tgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatt
aacaactgtcgtaactactaacggtgcataattattagacggattaagta
tcttacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaa
aaagg
back to top

gene from alignment at AF487173:1..905+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487173.1-LFY ID=AF487173.1-LFY|Name=LFY|organism=Physocarpus capitatus|type=gene|length=905bp|location=Sequence derived from alignment at AF487173:1..905+ (Physocarpus capitatus)
gcggtgagaaatgtcccaccaaggtacggacttaccctcctccctacgat attgttagaaacgataatttctactgtggtaaatacttgtaatttacaac ctgatctttgtgggcccattgtaggctagtgggccacaattgaagaggcc tgctgacaccctcaatataaatgttttgagctagctgtaggagcccaaat tcacaagaaatcaaaatctttaataggtttgttactaatttaggaacttt gccacttagcactacggtctagtggtatttctcttcacttgtaagtcaga ggtcttaggttcaagtctcggcaaatccattgtgtggcttagcctaattc tcacacttttagtgtaaatatcgttgtatttaaaaaaaaaactaatttag gaactttggattcctttggaattacttctatagaatacacttttacctat aaatacttcttttactaaaagcacaacaaaagcactcgggagtgcgtctc caagaaccataaaaatgcgttcattattttaaccaaacactatcagcagc acttgtggatttttgaaagcacttttagccctgtaatataggctctaaat attccaacatttatctaaatttggtttgactggccagatgttagacagtg attgatttcaaacatgggtcaagaccaaattgcataattttgtaggaaaa aagtctagacccaattgttagtgcattcgactattattatatccgatagg tgaatgttttcttttttgttctacagtttgaagtgtttttaactaacatt aacaactgtcgtaactactaacggtgcataattattagacggattaagta tcttacttattatatatgcaggtgacaaaccaggtgtttaggtatgccaa aaagg
back to top