LFY, AF487164.1-LFY (gene) Kageneckia oblonga

Gene Overview
NameLFY
Unique NameAF487164.1-LFY
Typegene
OrganismKageneckia oblonga ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYKageneckia oblongagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAF487164.1-LFY.m1Kageneckia oblongamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF487164.1
Alignments
Feature NameTypeLocationAnalysis
AF487164 region AF487164:1..698+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF487164.1-LFY ID=AF487164.1-LFY|Name=LFY|organism=Kageneckia oblonga|type=gene|length=698bp
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacga
gcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcg
gtgaaaaatctcccaccaaggtatgaagttttacccatcttcccttttac
ctgatttctactgttgtaattatcagtaaattcatcattgagtcattgat
cgctgtgggctcatttcctctagtacaattggagggcctgctactcacgg
catctatataaatttcagttgggttataggttctcgaatcgaacacaaat
ctttcttttttttaataatcaaactaaatacaaatattaaattgtcacgt
tcataatagtttcgttcatgtactgcaagttgcatcgacattggtcccta
caatttgcaaattactgaattttgaggtcacccgtcaaattttgttgaat
ccttgtatgaactccgttaaatttaccctttcgtgtaccacgtacataac
gatttggtacaagccaaggaattaatggaagttggggttcagggatgccc
tcgagttggaacaatttgcaatctacatgaactaaaaccgtgttgggggt
aaatatcgttttacatttgtttactctacacgttaaatatgcaggtgaca
aaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatcaac
back to top

gene from alignment at AF487164:1..698+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487164.1-LFY ID=AF487164.1-LFY|Name=LFY|organism=Kageneckia oblonga|type=gene|length=698bp|location=Sequence derived from alignment at AF487164:1..698+ (Kageneckia oblonga)
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacga gcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcg gtgaaaaatctcccaccaaggtatgaagttttacccatcttcccttttac ctgatttctactgttgtaattatcagtaaattcatcattgagtcattgat cgctgtgggctcatttcctctagtacaattggagggcctgctactcacgg catctatataaatttcagttgggttataggttctcgaatcgaacacaaat ctttcttttttttaataatcaaactaaatacaaatattaaattgtcacgt tcataatagtttcgttcatgtactgcaagttgcatcgacattggtcccta caatttgcaaattactgaattttgaggtcacccgtcaaattttgttgaat ccttgtatgaactccgttaaatttaccctttcgtgtaccacgtacataac gatttggtacaagccaaggaattaatggaagttggggttcagggatgccc tcgagttggaacaatttgcaatctacatgaactaaaaccgtgttgggggt aaatatcgttttacatttgtttactctacacgttaaatatgcaggtgaca aaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatcaac
back to top