LFY, AF487162.1-LFY (gene) Lyonothamnus floribundus

Gene Overview
NameLFY
Unique NameAF487162.1-LFY
Typegene
OrganismLyonothamnus floribundus ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYLyonothamnus floribundusgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LFYAF487162.1-LFY.m1Lyonothamnus floribundusmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF487162.1
Alignments
Feature NameTypeLocationAnalysis
AF487162 region AF487162:1..659+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF487162.1-LFY ID=AF487162.1-LFY|Name=LFY|organism=Lyonothamnus floribundus|type=gene|length=659bp
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacga
gctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcg
gtgaaaaatgtcccaccaaggtacggattatttacccacctcccttcatc
atcacatacgctgatttctactgtggtaaacagtaaaaaataaccacaaa
ataatgagatcaataaactatgatgttagttagcaaaaaaaaatacaatt
attataggcatgtgggcctagtattttagttggagaggcctgctgacagc
atcaataactccgggccggatctaaatctatcattgggtatgaggcagag
caactgcacaagaaaaacaaaatcataactaggtttatgtcacaagatta
gtttttaatccagctttaatcttaatttgatttgactatagtcagatgta
gatgtcgagttcaaccgcggattcgattacgatgtaataactgttaatca
aatgcaaatgcgatgataatctgacccgatttaacaaaatgtagaattca
ttttccgttgtactcagtgaaattgtggttaatgtagtgaacattgtgta
tataggtgacaaaccaagtgtttaggcatgctaaaaaggcaggcgcaagc
tacatcaac
back to top

gene from alignment at AF487162:1..659+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487162.1-LFY ID=AF487162.1-LFY|Name=LFY|organism=Lyonothamnus floribundus|type=gene|length=659bp|location=Sequence derived from alignment at AF487162:1..659+ (Lyonothamnus floribundus)
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacga gctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcg gtgaaaaatgtcccaccaaggtacggattatttacccacctcccttcatc atcacatacgctgatttctactgtggtaaacagtaaaaaataaccacaaa ataatgagatcaataaactatgatgttagttagcaaaaaaaaatacaatt attataggcatgtgggcctagtattttagttggagaggcctgctgacagc atcaataactccgggccggatctaaatctatcattgggtatgaggcagag caactgcacaagaaaaacaaaatcataactaggtttatgtcacaagatta gtttttaatccagctttaatcttaatttgatttgactatagtcagatgta gatgtcgagttcaaccgcggattcgattacgatgtaataactgttaatca aatgcaaatgcgatgataatctgacccgatttaacaaaatgtagaattca ttttccgttgtactcagtgaaattgtggttaatgtagtgaacattgtgta tataggtgacaaaccaagtgtttaggcatgctaaaaaggcaggcgcaagc tacatcaac
back to top