LFY, EU683936.1-LFY.m1 (mRNA) Crataegus nigra

Transcript Overview
Unique NameEU683936.1-LFY.m1
OrganismCrataegus nigra ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU683936.1-LFYCrataegus nigragene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus nigragene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU683936.1-LFY.m1-cds1EU683936.1-LFY.m1-cds1Crataegus nigraCDS
EU683936.1-LFY.m1-cds2EU683936.1-LFY.m1-cds2Crataegus nigraCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU683936.1-LFY.p1Crataegus nigrapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU683936 region EU683936:1..1038+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EU683936.1-LFY.m1 ID=EU683936.1-LFY.m1|Name=LFY|organism=Crataegus nigra|type=mRNA|length=591bp
back to top

protein sequence of LFY

>EU683936.1-LFY.p1 ID=EU683936.1-LFY.p1|Name=LFY|organism=Crataegus nigra|type=polypeptide|length=197bp
back to top

mRNA from alignment at EU683936:1..1038+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683936.1-LFY.m1 ID=EU683936.1-LFY.m1|Name=LFY|organism=Crataegus nigra|type=mRNA|length=1038bp|location=Sequence derived from alignment at EU683936:1..1038+ (Crataegus nigra)
gaagcaggcgtaacgccagtagcggcagctgctgcggcggcggctggtta tactttgcggccgccaagggagcttggacttggagggcttgaagacttgt tccaggcttatggggttagatactacacgacggcgaagatagcggagctt ggatttactgtgaacaccctcttggacatgaaggatgatgagcttgatga catgatgagcagcctctctcagatattccgctgggagttgcttgttgggg agaggtatggtatcaaagctgccgtcagagccgagcgccgccgccttgag gaggaggactctcggcggcgcaaccttgtctctggtgataccaccaccaa tgccctagatgctctctcccaacaaggtactatgaatattatttaccctt gtgtcttagattaaccgtagtatataggcatacaggtagggtttgattac actttgaaataacattatttacatgtaaattaatagtgcgacaaaataac atgttcaaacagatgataaaaaagaattagaatttagtgaatcaaagaag aaaaatagttcgcaaaacattaaaacttttggcctttggtgtaataattt gatggaaataacaaatcaaagatgtttattattctgtgacatactatgcc agatcataagatgttcgagattgcgtgataaaactaaaagcatatgtttt atatgattgtaacataatatgtcaattatcgtagtctttgatactagaac ataaagttgttgttatattagattgggatatatgacacgctgtgcatggg atgtgtagggctgtcggaggagccagtgcaacaagagaaggagatggtgg ggagcggagtagggatggcgtgggaggttgtgacggcgggggagaggcgg aagaagcagcggagggtgaagaaggggcaatataggaactgtagtgctgg agggggtcataataatgatcataacgagggtgtagacgacaaggacgacg acatggacgacatgaatgggcaggggaacggtggagga
back to top

Coding sequence (CDS) from alignment at EU683936:1..1038+

>EU683936.1-LFY.m1 ID=EU683936.1-LFY.m1|Name=LFY|organism=Crataegus nigra|type=CDS|length=591bp|location=Sequence derived from alignment at EU683936:1..1038+ (Crataegus nigra)
back to top