LFY, EU683954.1-LFY.m1 (mRNA) Crataegus monogyna

Transcript Overview
Unique NameEU683954.1-LFY.m1
OrganismCrataegus monogyna ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU683954.1-LFYCrataegus monogynagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus monogynagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU683954.1-LFY.m1-cds1EU683954.1-LFY.m1-cds1Crataegus monogynaCDS
EU683954.1-LFY.m1-cds2EU683954.1-LFY.m1-cds2Crataegus monogynaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU683954.1-LFY.p1Crataegus monogynapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU683954 region EU683954:1..618+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EU683954.1-LFY.m1 ID=EU683954.1-LFY.m1|Name=LFY|organism=Crataegus monogyna|type=mRNA|length=209bp
back to top

protein sequence of LFY

>EU683954.1-LFY.p1 ID=EU683954.1-LFY.p1|Name=LFY|organism=Crataegus monogyna|type=polypeptide|length=69bp
back to top

mRNA from alignment at EU683954:1..618+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683954.1-LFY.m1 ID=EU683954.1-LFY.m1|Name=LFY|organism=Crataegus monogyna|type=mRNA|length=618bp|location=Sequence derived from alignment at EU683954:1..618+ (Crataegus monogyna)
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatttctactgtggcaattaat taacagtaaaaattctaacgttagtcattgaaatcaacacaaatattaaa tggtcgcgtttgtaatggttttagttctatagtttccacatagttatagt ttcgttcatgtattgcaagtcgcatcgacataactcccgacaatttgcaa attgctgtaattcgaaggcacccgtcaaattttgttgaattcttgtatga agtccgtcaaatttaccatttcgtgtaccacatacataacgatctggtac aaggtattaacggaagttgaggtttagggatgtcctcgagttggaacaaa acgtacaatttcgttttgcatttgtttactctttacattatatatgcagg tgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatc aacaagcccaaaatgcgc
back to top

Coding sequence (CDS) from alignment at EU683954:1..618+

>EU683954.1-LFY.m1 ID=EU683954.1-LFY.m1|Name=LFY|organism=Crataegus monogyna|type=CDS|length=209bp|location=Sequence derived from alignment at EU683954:1..618+ (Crataegus monogyna)
back to top