LFY, EU683943.1-LFY.m1 (mRNA) Crataegus dahurica

Transcript Overview
Unique NameEU683943.1-LFY.m1
OrganismCrataegus dahurica ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU683943.1-LFYCrataegus dahuricagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus dahuricagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU683943.1-LFY.m1-cds1EU683943.1-LFY.m1-cds1Crataegus dahuricaCDS
EU683943.1-LFY.m1-cds2EU683943.1-LFY.m1-cds2Crataegus dahuricaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU683943.1-LFY.p1Crataegus dahuricapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU683943 region EU683943:1..441+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EU683943.1-LFY.m1 ID=EU683943.1-LFY.m1|Name=LFY|organism=Crataegus dahurica|type=mRNA|length=209bp
back to top

protein sequence of LFY

>EU683943.1-LFY.p1 ID=EU683943.1-LFY.p1|Name=LFY|organism=Crataegus dahurica|type=polypeptide|length=69bp
back to top

mRNA from alignment at EU683943:1..441+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU683943.1-LFY.m1 ID=EU683943.1-LFY.m1|Name=LFY|organism=Crataegus dahurica|type=mRNA|length=441bp|location=Sequence derived from alignment at EU683943:1..441+ (Crataegus dahurica)
tggtgacggarccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtgca gaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagtt ttacccgtctcccctctttacgtacgctgatttctactgtggcaattaat taacagaaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgta ccacatacataacgatctggtacaaggtattaacggaagttgaggtttag ggatgtcctcgagttggaacaaaatgtataatttccttttgcatttgttt actctttacattatatacgcaggtgacaaaccaagtgtttaggtatgcca aaaaggcaggggcaagctacatcaacaaacccaaaatgagm
back to top

Coding sequence (CDS) from alignment at EU683943:1..441+

>EU683943.1-LFY.m1 ID=EU683943.1-LFY.m1|Name=LFY|organism=Crataegus dahurica|type=CDS|length=209bp|location=Sequence derived from alignment at EU683943:1..441+ (Crataegus dahurica)
back to top