LFY, EU500527.1-LFY.m1 (mRNA) Crataegus submollis

Transcript Overview
Unique NameEU500527.1-LFY.m1
OrganismCrataegus submollis ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEU500527.1-LFYCrataegus submollisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus submollisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU500527.1-LFY.m1-cds1EU500527.1-LFY.m1-cds1Crataegus submollisCDS
EU500527.1-LFY.m1-cds2EU500527.1-LFY.m1-cds2Crataegus submollisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEU500527.1-LFY.p1Crataegus submollispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU500527 region EU500527:1..420+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EU500527.1-LFY.m1 ID=EU500527.1-LFY.m1|Name=LFY|organism=Crataegus submollis|type=mRNA|length=209bp
back to top

protein sequence of LFY

>EU500527.1-LFY.p1 ID=EU500527.1-LFY.p1|Name=LFY|organism=Crataegus submollis|type=polypeptide|length=69bp
back to top

mRNA from alignment at EU500527:1..420+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU500527.1-LFY.m1 ID=EU500527.1-LFY.m1|Name=LFY|organism=Crataegus submollis|type=mRNA|length=420bp|location=Sequence derived from alignment at EU500527:1..420+ (Crataegus submollis)
tggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcgat tacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcca gaacattgccaaggagcgcggcgaaaaatgtcccaccaaggtacgaagtt ttacccatctcccctctttacgtacgctgatgatttctactgtggcaatt aattaacagtaaaaattcttgtacgaagtccgtcaaatttaccatttcgt gtaccacatacataacgatctggtacaaggtattaacggaagttggaaca aaatgtataatttcgttttgcatttgtttgctctttacattatatatgca ggtgacaaaccaagtgtttaggtatgccaaaaaggcaggggcaagctaca tcaacaaacccaaaatgcgc
back to top

Coding sequence (CDS) from alignment at EU500527:1..420+

>EU500527.1-LFY.m1 ID=EU500527.1-LFY.m1|Name=LFY|organism=Crataegus submollis|type=CDS|length=209bp|location=Sequence derived from alignment at EU500527:1..420+ (Crataegus submollis)
back to top