S4-RNase, AF432418.1-S4-RNase (gene) Prunus salicina

Gene Overview
NameS4-RNase
Unique NameAF432418.1-S4-RNase
Typegene
OrganismPrunus salicina ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S4-RNaseS4-RNasePrunus salicinagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
S4-RNaseAF432418.1-S4-RNase.m1Prunus salicinamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAF432418.1
Alignments
Feature NameTypeLocationAnalysis
AF432418 region AF432418:1..1283+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF432418.1-S4-RNase ID=AF432418.1-S4-RNase|Name=S4-RNase|organism=Prunus salicina|type=gene|length=1283bp
ctatggccaagtaattattcaaacccaaagattcccagtaattgcaaggg
ggcgctatttggggcaaggaaagtggtatgtacgcatttagtttttagaa
aaattagattgtcacatgaagacaatatactttgttgataaaccttgggt
gttagataaatcctgatgttgctcttctgcttgggaacattattttagat
atatacacctaagcacacatttatatttgtagctatattaatgtacctac
ctacctacctatacatttataaaagagtactcctattttcatccacccac
cttatcttcaaaattttaaagagaaatttacccatttgtaaaatgacttc
taaaaggacttggggaaaaaagcctcaactcacgtaacccacctattcta
ccgtttgacaaaaagaagaagaagaagaagaaagcgcaatagaaaattac
cttcaaatgtataaatttctctttaaaacatttatccataatattttcaa
aaactacaaggcatataattaaaaaactaaaagatcctgaaaatcaaaat
attggactaaaacatttattgagtccatcaaacacaacttgatcctctcc
atatctcaattactaatgattagcaaagaaaaatagcttgaattaataat
taaagggtattttaggaataatggtgggtggaaggataagattgtatttt
ttcaaatttacatggtgagtgggaaaataggacatggggtggaaataaca
gcactcttataaaaatataagcgatgtcaacggagtctagcatagtgaaa
aatgacattaacttgcaaacaacatgtctcgggttcgaccccgatagcat
cttcattttttgtgtgtgtgaaaaatcaccatctcctgtagtttagacta
tcttttgtactccaaaaaatgtaaatgatcatctaattaaagcacctatc
atatcgtgcttacgtatatatttaactattgtacatctaaatcaaaattc
agtacaatactcaggtttaatatagaaaacaatctaattgaagaatggat
gtatgtgttgcttggatgtctcagtaccctcagttgcaattgaacctgaa
gatatcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaa
gcgaatggaacaagcatggcacatgttctgaacggacactcaaccaaatg
caatacttcgagcgatcagacgaaatgtggaactcgtacaatattacaga
gatccttaaaaacgcttcaatcgtaccacatcc
back to top

gene from alignment at AF432418:1..1283+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF432418.1-S4-RNase ID=AF432418.1-S4-RNase|Name=S4-RNase|organism=Prunus salicina|type=gene|length=1283bp|location=Sequence derived from alignment at AF432418:1..1283+ (Prunus salicina)
ctatggccaagtaattattcaaacccaaagattcccagtaattgcaaggg ggcgctatttggggcaaggaaagtggtatgtacgcatttagtttttagaa aaattagattgtcacatgaagacaatatactttgttgataaaccttgggt gttagataaatcctgatgttgctcttctgcttgggaacattattttagat atatacacctaagcacacatttatatttgtagctatattaatgtacctac ctacctacctatacatttataaaagagtactcctattttcatccacccac cttatcttcaaaattttaaagagaaatttacccatttgtaaaatgacttc taaaaggacttggggaaaaaagcctcaactcacgtaacccacctattcta ccgtttgacaaaaagaagaagaagaagaagaaagcgcaatagaaaattac cttcaaatgtataaatttctctttaaaacatttatccataatattttcaa aaactacaaggcatataattaaaaaactaaaagatcctgaaaatcaaaat attggactaaaacatttattgagtccatcaaacacaacttgatcctctcc atatctcaattactaatgattagcaaagaaaaatagcttgaattaataat taaagggtattttaggaataatggtgggtggaaggataagattgtatttt ttcaaatttacatggtgagtgggaaaataggacatggggtggaaataaca gcactcttataaaaatataagcgatgtcaacggagtctagcatagtgaaa aatgacattaacttgcaaacaacatgtctcgggttcgaccccgatagcat cttcattttttgtgtgtgtgaaaaatcaccatctcctgtagtttagacta tcttttgtactccaaaaaatgtaaatgatcatctaattaaagcacctatc atatcgtgcttacgtatatatttaactattgtacatctaaatcaaaattc agtacaatactcaggtttaatatagaaaacaatctaattgaagaatggat gtatgtgttgcttggatgtctcagtaccctcagttgcaattgaacctgaa gatatcttggccggacgtaaaaagtggcaacgagacaaatttttggcaaa gcgaatggaacaagcatggcacatgttctgaacggacactcaaccaaatg caatacttcgagcgatcagacgaaatgtggaactcgtacaatattacaga gatccttaaaaacgcttcaatcgtaccacatcc
back to top