GAPDH, EU315078.1-GAPDH.m1 (mRNA) Rosa gymnocarpa

Transcript Overview
Unique NameEU315078.1-GAPDH.m1
OrganismRosa gymnocarpa ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHEU315078.1-GAPDHRosa gymnocarpagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
GAPDHGAPDHRosa gymnocarpagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EU315078.1-GAPDH.m1-cds1EU315078.1-GAPDH.m1-cds1Rosa gymnocarpaCDS
EU315078.1-GAPDH.m1-cds2EU315078.1-GAPDH.m1-cds2Rosa gymnocarpaCDS
EU315078.1-GAPDH.m1-cds3EU315078.1-GAPDH.m1-cds3Rosa gymnocarpaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
GAPDHEU315078.1-GAPDH.p1Rosa gymnocarpapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EU315078 region EU315078:92..644+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productglyceraldehyde 3-phosphate dehydrogenase
The following sequences are available for this feature:

mRNA sequence

>EU315078.1-GAPDH.m1 ID=EU315078.1-GAPDH.m1|Name=GAPDH|organism=Rosa gymnocarpa|type=mRNA|length=325bp
back to top

protein sequence of GAPDH

>EU315078.1-GAPDH.p1 ID=EU315078.1-GAPDH.p1|Name=GAPDH|organism=Rosa gymnocarpa|type=polypeptide|length=107bp
back to top

mRNA from alignment at EU315078:92..644+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU315078.1-GAPDH.m1 ID=EU315078.1-GAPDH.m1|Name=GAPDH|organism=Rosa gymnocarpa|type=mRNA|length=553bp|location=Sequence derived from alignment at EU315078:92..644+ (Rosa gymnocarpa)
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggt attttcaatgttctttgtgccactgcttcagtattgttgatacactttta agttacatgtcagtgatacttcatctgtaacagctttattaatccttgat tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggca agttgaccggaatggctttccgtgtacccactgttgatgtttcagttgtt gacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc tgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaa ggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatc tttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatc ttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaa cag
back to top

Coding sequence (CDS) from alignment at EU315078:92..644+

>EU315078.1-GAPDH.m1 ID=EU315078.1-GAPDH.m1|Name=GAPDH|organism=Rosa gymnocarpa|type=CDS|length=325bp|location=Sequence derived from alignment at EU315078:92..644+ (Rosa gymnocarpa)
back to top