SFB17, EU652885.1-SFB17 (gene) Prunus armeniaca

Gene Overview
NameSFB17
Unique NameEU652885.1-SFB17
Typegene
OrganismPrunus armeniaca (Apricot)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SFB17SFB17Prunus armeniacagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
SFB17EU652885.1-SFB17.m1Prunus armeniacamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreEU652885.1
Alignments
Feature NameTypeLocationAnalysis
EU652885 region EU652885:1..1131+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>EU652885.1-SFB17 ID=EU652885.1-SFB17|Name=SFB17|organism=Prunus armeniaca|type=gene|length=1131bp
atggcatcgacactacgtaagaaagaaatcttagtcgacatcctactaag
actacctgcaaaatccctcgttcggtttctttgtacatgcaagttatgga
gtaatttgatttgcagcttgagtttcgctagcacacaccttcacaggaat
gtcacaggacatgcccatgcctatctactttgcctccaccagccaaattt
tgaatgtcaaagggacgatgatgacccatattttaaagaagaactccaat
ggtcattgttttccaatgtaacatttgagcagtgctgcacgttaagccat
ccattagggagcacagaacattatgggatatatggttcaagcaatggttt
agtttgcatttcggatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttaggacccctccaatgagcaccaacact
aacattaaatttagctatgttgctcttcaattcgggtttcactccggagt
taatgactacaaggttgttaggatgatgcgtaccaacaaaaatgccttgg
cggttgaggtttatagtcttggtacagactgctggaagctgattcaagca
attcctccttggttaaaatgcacttggaagcatcacaagggtacattttt
gaatggagtagcataccacatcattgagaaaggtcctatattcagcatta
tgtccttcgattcaggcagtgaagacttcgaagaattcatagcaccagat
gccatttgcaattcatggaagttatgcatccaagtttacaaggaacagat
ttgcttgctttttggattttatggttgtgaggaggagggcatggaaaaca
ttgacatatgggttctgcaagaaaaacggtggaaacaattgtatcctttt
atttatgatcctttggattgctgttatcagataatcgggactagtataaa
caatgaactcttaatggcaagaagagatttcgatgacggggtagtaggtc
tgcaattgggtaattacgaatccaagcaagttcttgacacagggattaag
ttggccatcatgagatatggggaaatcgaattcttgtttgcaattactta
catagaaagtttagttttactcaataactaa
back to top

gene from alignment at EU652885:1..1131+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>EU652885.1-SFB17 ID=EU652885.1-SFB17|Name=SFB17|organism=Prunus armeniaca|type=gene|length=1131bp|location=Sequence derived from alignment at EU652885:1..1131+ (Prunus armeniaca)
atggcatcgacactacgtaagaaagaaatcttagtcgacatcctactaag actacctgcaaaatccctcgttcggtttctttgtacatgcaagttatgga gtaatttgatttgcagcttgagtttcgctagcacacaccttcacaggaat gtcacaggacatgcccatgcctatctactttgcctccaccagccaaattt tgaatgtcaaagggacgatgatgacccatattttaaagaagaactccaat ggtcattgttttccaatgtaacatttgagcagtgctgcacgttaagccat ccattagggagcacagaacattatgggatatatggttcaagcaatggttt agtttgcatttcggatgagatattgaattttgatagtcctatacacatat ggaacccatcggttaggaaacttaggacccctccaatgagcaccaacact aacattaaatttagctatgttgctcttcaattcgggtttcactccggagt taatgactacaaggttgttaggatgatgcgtaccaacaaaaatgccttgg cggttgaggtttatagtcttggtacagactgctggaagctgattcaagca attcctccttggttaaaatgcacttggaagcatcacaagggtacattttt gaatggagtagcataccacatcattgagaaaggtcctatattcagcatta tgtccttcgattcaggcagtgaagacttcgaagaattcatagcaccagat gccatttgcaattcatggaagttatgcatccaagtttacaaggaacagat ttgcttgctttttggattttatggttgtgaggaggagggcatggaaaaca ttgacatatgggttctgcaagaaaaacggtggaaacaattgtatcctttt atttatgatcctttggattgctgttatcagataatcgggactagtataaa caatgaactcttaatggcaagaagagatttcgatgacggggtagtaggtc tgcaattgggtaattacgaatccaagcaagttcttgacacagggattaag ttggccatcatgagatatggggaaatcgaattcttgtttgcaattactta catagaaagtttagttttactcaataactaa
back to top