LFY, EF127077.1-LFY.m1 (mRNA) Mespilus germanica

Transcript Overview
Unique NameEF127077.1-LFY.m1
OrganismMespilus germanica ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEF127077.1-LFYMespilus germanicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYMespilus germanicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF127077.1-LFY.m1-cds1EF127077.1-LFY.m1-cds1Mespilus germanicaCDS
EF127077.1-LFY.m1-cds2EF127077.1-LFY.m1-cds2Mespilus germanicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEF127077.1-LFY.p1Mespilus germanicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EF127077 region EF127077:1..397+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EF127077.1-LFY.m1 ID=EF127077.1-LFY.m1|Name=LFY|organism=Mespilus germanica|type=mRNA|length=210bp
back to top

protein sequence of LFY

>EF127077.1-LFY.p1 ID=EF127077.1-LFY.p1|Name=LFY|organism=Mespilus germanica|type=polypeptide|length=70bp
back to top

mRNA from alignment at EF127077:1..397+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127077.1-LFY.m1 ID=EF127077.1-LFY.m1|Name=LFY|organism=Mespilus germanica|type=mRNA|length=397bp|location=Sequence derived from alignment at EF127077:1..397+ (Mespilus germanica)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcgcggtgaaaaatgtcccaccaaggtacgaagt tttacccatctcccctcttacgtacgctgatttctactgtggcaattaat taacagtaaaaattctaatattaaatggtcgcgtttgtaatggttttagt tctatagtttccacatagttatggtttcgttcacgtattgcaagtcgcat ttgtttactcattacattatatatgcaggtgacaaaccaagtgtttaggt atgccaaaaaggcaggggcaagctacatcaacaagcccaaaatgcgc
back to top

Coding sequence (CDS) from alignment at EF127077:1..397+

>EF127077.1-LFY.m1 ID=EF127077.1-LFY.m1|Name=LFY|organism=Mespilus germanica|type=CDS|length=210bp|location=Sequence derived from alignment at EF127077:1..397+ (Mespilus germanica)
back to top