LFY, EF127071.1-LFY.m1 (mRNA) Crataegus phaenopyrum

Transcript Overview
Unique NameEF127071.1-LFY.m1
OrganismCrataegus phaenopyrum ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYEF127071.1-LFYCrataegus phaenopyrumgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYCrataegus phaenopyrumgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF127071.1-LFY.m1-cds1EF127071.1-LFY.m1-cds1Crataegus phaenopyrumCDS
EF127071.1-LFY.m1-cds2EF127071.1-LFY.m1-cds2Crataegus phaenopyrumCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYEF127071.1-LFY.p1Crataegus phaenopyrumpolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
EF127071 region EF127071:1..442+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>EF127071.1-LFY.m1 ID=EF127071.1-LFY.m1|Name=LFY|organism=Crataegus phaenopyrum|type=mRNA|length=210bp
back to top

protein sequence of LFY

>EF127071.1-LFY.p1 ID=EF127071.1-LFY.p1|Name=LFY|organism=Crataegus phaenopyrum|type=polypeptide|length=70bp
back to top

mRNA from alignment at EF127071:1..442+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF127071.1-LFY.m1 ID=EF127071.1-LFY.m1|Name=LFY|organism=Crataegus phaenopyrum|type=mRNA|length=442bp|location=Sequence derived from alignment at EF127071:1..442+ (Crataegus phaenopyrum)
atggtgacggagccgggggaggtggcgcgtggcaaaaagaacggcctcga ttacctcttccatctctacgagcaatgccgcgatttcttgatccaggtcc agaacattgccaaggagcggggtgaaaaatgtcccaccaaggtacgaagt tttacccatctcccctctttacgtacgctgatttctactgtggccattaa ttaacagtaaaaattcttgtatgaagtccgtcaaatttaccatttcgtgt accgcatacataacgatctggtacaaggtattaacggaagttgaggttta gggatgtcctggagttggaacaaaatgyataatttcgttttgcatttgtt tactctttacattatatatgcaggtgacaaaccaagtktttaggtatgcc aaaaaggcaggggcaagctacatcaacaagcccaaratgcgc
back to top

Coding sequence (CDS) from alignment at EF127071:1..442+

>EF127071.1-LFY.m1 ID=EF127071.1-LFY.m1|Name=LFY|organism=Crataegus phaenopyrum|type=CDS|length=210bp|location=Sequence derived from alignment at EF127071:1..442+ (Crataegus phaenopyrum)
back to top