A3GT, AB292796.1-A3GT (gene) Rosa hybrid cultivar

Gene Overview
NameA3GT
Unique NameAB292796.1-A3GT
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
A3GTA3GTRosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
A3GTAB292796.1-A3GT.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAB292796.1
Alignments
Feature NameTypeLocationAnalysis
AB292796 region AB292796:679..2272+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AB292796.1-A3GT ID=AB292796.1-A3GT|Name=A3GT|organism=Rosa hybrid cultivar|type=gene|length=1407bp
atggcaccagcatcaaatcaggtgggtggtcatgtggcggtgctagcctt
tcccttctcgactcacgccgccccgctgttgaacatcgtctgccgcctcg
ccgccgccgccccaaacaccctcttctcattcttcaacaccaagcaatcc
aatagctcgatcctagcaagcaacacgtcatccatactacgtaacagtaa
cgtaagggtgtgtgaggtggcggatggtgtgccggaggggtatgtttttg
tgggtaagcctcaggaggacatagagttgttcatgaaggctgccccggac
aacttcaggcggtgcttagaggcgtccgtggcggagaccgggagggaggt
cagctgcttggtcactgacgctttcttttggttcggggctcacatggccg
atgacttgggaggactgccttgggtaccgttttggaccgccgggccagct
tcactctccgctcatgtacacaccgatctcatcaggaacacaactagtat
gggtggtcacgatggaaaagaaaccatcactgcagtcactgcaggaatgt
ccaaagtacgaccccaggatttgccagagggaatcatctttggaaagttg
gactccctcttttcacggatgctacaccagatgggactaatgctaccact
tgcaacagcagttttcatcaactccttcgaagaactagaccctgtgatca
caaatgatttgaagtccaaattcaagaggtacctcaacgtgggacccttc
gacctactagagtcaccagcaccagcagccaccaccacactgcagactgg
ggacgttgttgtcggagatggctgcttatcgtggcttgacaaacagaagg
cggcgtctgtagtgtatgtgagttttggatcagtaacaagaccatcgccg
gaggagcttatggcgctagccgaggcgttggaagccagtagggttccatt
cttgtggtctcttcggaacaatttgatgactcctaagctagacgagttca
taagcaaagcagaattaaacgggatggtggtgccttgggtgccacaacca
caggtcctagcacatggttcagttggagcattcgtaacacattgtggttg
gaactcggtgcttgagagcctagcaggtggagtgcccatgatctgcaggc
ctttcttcggcgatcagaaacttaacgcgaggatggtagaggatgagtgg
aagattggtctcaaattggagggtggggttttcaccaagaatgggatgct
taagagtttggacatactactgtcgcaaaagaaggggaacataatgagag
acacgatcaacacattcaaacaactcgcacaacaggccgtagaaccaaaa
gggagctccactaggaactttgaatcattgttggaagtgatatctacagc
caattaa
back to top

gene from alignment at AB292796:679..2272+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AB292796.1-A3GT ID=AB292796.1-A3GT|Name=A3GT|organism=Rosa hybrid cultivar|type=gene|length=1594bp|location=Sequence derived from alignment at AB292796:679..2272+ (Rosa hybrid cultivar)
atggcaccagcatcaaatcaggtgggtggtcatgtggcggtgctagcctt tcccttctcgactcacgccgccccgctgttgaacatcgtctgccgcctcg ccgccgccgccccaaacaccctcttctcattcttcaacaccaagcaatcc aatagctcgatcctagcaagcaacacgtcatccatactacgtaacagtaa cgtaagggtgtgtgaggtggcggatggtgtgccggaggggtatgtttttg tgggtaagcctcaggaggacatagagttgttcatgaaggctgccccggac aacttcaggcggtgcttagaggcgtccgtggcggagaccgggagggaggt cagctgcttggtcactgacgctttcttttggttcggggctcacatggccg atgacttgggaggactgccttgggtaccgttttggaccgccgggccagct tcactctccgctcatgtacacaccgatctcatcaggaacacaactagtac gtgtatacatatattatgattcatcaatatcatatataccgaattattaa tgctttatttaattagtctcgtcatgtgtgtaccaaaacaagcagacaca agtacacatacatatctattgacaccaaaatggttatattactagctgac ttgtctcgatcattcatatgttcaaataaacaggtatgggtggtcacgat ggaaaagaaaccatcactgcagtcactgcaggaatgtccaaagtacgacc ccaggatttgccagagggaatcatctttggaaagttggactccctctttt cacggatgctacaccagatgggactaatgctaccacttgcaacagcagtt ttcatcaactccttcgaagaactagaccctgtgatcacaaatgatttgaa gtccaaattcaagaggtacctcaacgtgggacccttcgacctactagagt caccagcaccagcagccaccaccacactgcagactggggacgttgttgtc ggagatggctgcttatcgtggcttgacaaacagaaggcggcgtctgtagt gtatgtgagttttggatcagtaacaagaccatcgccggaggagcttatgg cgctagccgaggcgttggaagccagtagggttccattcttgtggtctctt cggaacaatttgatgactcctaagctagacgagttcataagcaaagcaga attaaacgggatggtggtgccttgggtgccacaaccacaggtcctagcac atggttcagttggagcattcgtaacacattgtggttggaactcggtgctt gagagcctagcaggtggagtgcccatgatctgcaggcctttcttcggcga tcagaaacttaacgcgaggatggtagaggatgagtggaagattggtctca aattggagggtggggttttcaccaagaatgggatgcttaagagtttggac atactactgtcgcaaaagaaggggaacataatgagagacacgatcaacac attcaaacaactcgcacaacaggccgtagaaccaaaagggagctccacta ggaactttgaatcattgttggaagtgatatctacagccaattaa
back to top