BRP41, AM268395.1-BRP41 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP41
Unique NameAM268395.1-BRP41
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP41BRP41Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP41AM268395.1-BRP41.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM268395.1
Alignments
Feature NameTypeLocationAnalysis
AM268395 region AM268395:1..664+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM268395.1-BRP41 ID=AM268395.1-BRP41|Name=BRP41|organism=Rosa hybrid cultivar|type=gene|length=664bp
ggggggatggggaaaacgaccattgctagtgctgtttatgatgaaattgc
tcctcaatttgaacactgttgctttcttgagaatatcaacgaaggtttca
cgaagcatggggcagtatatatgcaagcaaaacttctatcaggaatgttg
aaggaaaagatgcagagtttaggcaatttgaatgcaggttacaatatgat
gatggaaaaactaggtatgaaaaaagttctagtcgtttttgatgatgtac
ataatactacccagattgaagccttacttggaaaaccatattcatttggt
tgtgggagtagaatcattataacaactagaaaggaaacaataatgagtgg
atgtcagatatattgtcccaatctattagatgatgaagctgttaaactct
tcaggcattttgctttcagaacaatcaattgctcagatgagtatgatctt
ctctcacggcgtgccattggatgtgctcaacgtctgcctttagcacttaa
agtcttaggatcttttctttttgacaaaagtatcgaagagtgggaagttg
ccttgaaaggactagaaagattctctagcagaggagttgaaagtgtgttt
tttaaaagctttgatgacctacatgattcagagaagaccatatttctcga
tatcgcctgtttta
back to top

gene from alignment at AM268395:1..664+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM268395.1-BRP41 ID=AM268395.1-BRP41|Name=BRP41|organism=Rosa hybrid cultivar|type=gene|length=664bp|location=Sequence derived from alignment at AM268395:1..664+ (Rosa hybrid cultivar)
ggggggatggggaaaacgaccattgctagtgctgtttatgatgaaattgc tcctcaatttgaacactgttgctttcttgagaatatcaacgaaggtttca cgaagcatggggcagtatatatgcaagcaaaacttctatcaggaatgttg aaggaaaagatgcagagtttaggcaatttgaatgcaggttacaatatgat gatggaaaaactaggtatgaaaaaagttctagtcgtttttgatgatgtac ataatactacccagattgaagccttacttggaaaaccatattcatttggt tgtgggagtagaatcattataacaactagaaaggaaacaataatgagtgg atgtcagatatattgtcccaatctattagatgatgaagctgttaaactct tcaggcattttgctttcagaacaatcaattgctcagatgagtatgatctt ctctcacggcgtgccattggatgtgctcaacgtctgcctttagcacttaa agtcttaggatcttttctttttgacaaaagtatcgaagagtgggaagttg ccttgaaaggactagaaagattctctagcagaggagttgaaagtgtgttt tttaaaagctttgatgacctacatgattcagagaagaccatatttctcga tatcgcctgtttta
back to top