BRP37, AM075245.1-BRP37 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP37
Unique NameAM075245.1-BRP37
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP37BRP37Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP37AM075245.1-BRP37.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075245.1
Alignments
Feature NameTypeLocationAnalysis
AM075245 region AM075245:1..677+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075245.1-BRP37 ID=AM075245.1-BRP37|Name=BRP37|organism=Rosa hybrid cultivar|type=gene|length=677bp
cttgcccaagatgcctataacgatgaaagggttacagcccattttgataa
gaaagtatgggtttgtgtctcagacccttttgatgagatcaagattgcta
aagcgatcattgaaagtctcgtaggaaccccaaacagttcaaatgagttg
gaaattttattgcaatgtatcaagactcatatcgagaatcatatcgagaa
taggaagttacttcttgttctagatgatgtgtggaccgaagacgaaacaa
agtgggaaaatttgaaactaccaataataatgcaaagttgtgaagaagga
agttcaatactggtgaccacgcgaaaacaagaggttgctaaaattatgag
agcaaccaacaacatgatccatttagatgagttgaattataaggattgtt
tggctttgttcaatagcattgcgtttttggatagggatgaagatgaggct
gatgagttgggagatattggtaagaaaattgtgaaacggtgtaaaggttt
gcctcttgctgcaaagactttaggtagtctagtgtggtataagaaaacaa
gaaaggaatgggaggatgttctgaagagtgagatatgggaattagaaaaa
gttgagcaacatgttttccgaccactgttgcttagttattatgatttggc
tcctgcagtcaaaagatgtcttttgta
back to top

gene from alignment at AM075245:1..677+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075245.1-BRP37 ID=AM075245.1-BRP37|Name=BRP37|organism=Rosa hybrid cultivar|type=gene|length=677bp|location=Sequence derived from alignment at AM075245:1..677+ (Rosa hybrid cultivar)
cttgcccaagatgcctataacgatgaaagggttacagcccattttgataa gaaagtatgggtttgtgtctcagacccttttgatgagatcaagattgcta aagcgatcattgaaagtctcgtaggaaccccaaacagttcaaatgagttg gaaattttattgcaatgtatcaagactcatatcgagaatcatatcgagaa taggaagttacttcttgttctagatgatgtgtggaccgaagacgaaacaa agtgggaaaatttgaaactaccaataataatgcaaagttgtgaagaagga agttcaatactggtgaccacgcgaaaacaagaggttgctaaaattatgag agcaaccaacaacatgatccatttagatgagttgaattataaggattgtt tggctttgttcaatagcattgcgtttttggatagggatgaagatgaggct gatgagttgggagatattggtaagaaaattgtgaaacggtgtaaaggttt gcctcttgctgcaaagactttaggtagtctagtgtggtataagaaaacaa gaaaggaatgggaggatgttctgaagagtgagatatgggaattagaaaaa gttgagcaacatgttttccgaccactgttgcttagttattatgatttggc tcctgcagtcaaaagatgtcttttgta
back to top