BRP33, AM075241.1-BRP33 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP33
Unique NameAM075241.1-BRP33
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP33BRP33Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP33AM075241.1-BRP33.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075241.1
Alignments
Feature NameTypeLocationAnalysis
AM075241 region AM075241:1..509+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075241.1-BRP33 ID=AM075241.1-BRP33|Name=BRP33|organism=Rosa hybrid cultivar|type=gene|length=509bp
ttgctagagttactgacaaactacttggagtctaaaaaatacctagttgt
tctagatgatgtgtgggagataagagtttggagagaaataaaggtgtcac
ttcaagatagacaactcggaagtcgaatagtacttacaactcgaaatgaa
gaagtagcatccaactcttttggagttgaaagctatgttcaccatattca
gcccctgcacaataatgaggcttgggaacttttccgcaagaaagcattct
ccactaatcagcacaaaacttgtccgcttgagcttgagtcattggcttgc
caacttgtggaaaagtgtggaggccttcctttggctattgtggctttagg
tggtcttatgtcttccaagaagtccctggatcaatggcaacgagtctgca
acagcttaaactggcatctagataacaattcattgctagaccctgtgaaa
aacatcctgttgctgagtttcaatgatttgccatctcaactgaagcattg
cttcctcta
back to top

gene from alignment at AM075241:1..509+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075241.1-BRP33 ID=AM075241.1-BRP33|Name=BRP33|organism=Rosa hybrid cultivar|type=gene|length=509bp|location=Sequence derived from alignment at AM075241:1..509+ (Rosa hybrid cultivar)
ttgctagagttactgacaaactacttggagtctaaaaaatacctagttgt tctagatgatgtgtgggagataagagtttggagagaaataaaggtgtcac ttcaagatagacaactcggaagtcgaatagtacttacaactcgaaatgaa gaagtagcatccaactcttttggagttgaaagctatgttcaccatattca gcccctgcacaataatgaggcttgggaacttttccgcaagaaagcattct ccactaatcagcacaaaacttgtccgcttgagcttgagtcattggcttgc caacttgtggaaaagtgtggaggccttcctttggctattgtggctttagg tggtcttatgtcttccaagaagtccctggatcaatggcaacgagtctgca acagcttaaactggcatctagataacaattcattgctagaccctgtgaaa aacatcctgttgctgagtttcaatgatttgccatctcaactgaagcattg cttcctcta
back to top