BRP22, AM075230.1-BRP22 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP22
Unique NameAM075230.1-BRP22
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP22BRP22Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP22AM075230.1-BRP22.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075230.1
Alignments
Feature NameTypeLocationAnalysis
AM075230 region AM075230:1..662+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075230.1-BRP22 ID=AM075230.1-BRP22|Name=BRP22|organism=Rosa hybrid cultivar|type=gene|length=662bp
cttgctggtgttgtattcaaccgactctcatctcaattcgaagcttccta
tttccttgctgatgtcagggaaaaatatggcaaagatagaccacacggtt
tgcgagatgaactttttcgcaacttattgaaggatgaaagtctaaggatc
ggcactccatccgtaggatcaactttaaccaaacagaggctctcccgtac
aaaggtcctcgttgtgcttgatgatgtgaatgatgttaggcaactagaaa
ctttagttggtgatcaggttcaatttggacccggaagtagaatcattata
acaactagagatatgcatcaacttagagagatgcgacagctgcgtaaagg
agctaaccatgatgttgtaatatacaaggcagaggaactagatcgtaatg
aagcacttcagctcttccacttgaatgattctgaggaaatcagttgcgga
gcagaatataccgaattagtgagaacggtggtgcattatgctgcgggaat
tcccttagcccttaaaatatggggttccttatttcgtcgatgcaagagca
cacaagagcgggaaagtttcttgaaaaagttgaaaaggtttcctgaaaag
aaacttcaagatgtgtataggataagttatgatgcattaggagaaaatga
gagggagatatt
back to top

gene from alignment at AM075230:1..662+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075230.1-BRP22 ID=AM075230.1-BRP22|Name=BRP22|organism=Rosa hybrid cultivar|type=gene|length=662bp|location=Sequence derived from alignment at AM075230:1..662+ (Rosa hybrid cultivar)
cttgctggtgttgtattcaaccgactctcatctcaattcgaagcttccta tttccttgctgatgtcagggaaaaatatggcaaagatagaccacacggtt tgcgagatgaactttttcgcaacttattgaaggatgaaagtctaaggatc ggcactccatccgtaggatcaactttaaccaaacagaggctctcccgtac aaaggtcctcgttgtgcttgatgatgtgaatgatgttaggcaactagaaa ctttagttggtgatcaggttcaatttggacccggaagtagaatcattata acaactagagatatgcatcaacttagagagatgcgacagctgcgtaaagg agctaaccatgatgttgtaatatacaaggcagaggaactagatcgtaatg aagcacttcagctcttccacttgaatgattctgaggaaatcagttgcgga gcagaatataccgaattagtgagaacggtggtgcattatgctgcgggaat tcccttagcccttaaaatatggggttccttatttcgtcgatgcaagagca cacaagagcgggaaagtttcttgaaaaagttgaaaaggtttcctgaaaag aaacttcaagatgtgtataggataagttatgatgcattaggagaaaatga gagggagatatt
back to top