BRP16, AM075224.1-BRP16 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP16
Unique NameAM075224.1-BRP16
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP16BRP16Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP16AM075224.1-BRP16.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075224.1
Alignments
Feature NameTypeLocationAnalysis
AM075224 region AM075224:1..475+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075224.1-BRP16 ID=AM075224.1-BRP16|Name=BRP16|organism=Rosa hybrid cultivar|type=gene|length=475bp
gttgccaaagctgtatatgggtcaatcgctcatcgatttgaaggtagctg
ttttttggaaaatgtgagagaaaggtcattagtgccacatgaaggcttgg
ttcaattgcaagaaactcttctttccaaaattttagggggtgtaggagtg
aagctgagcaatgttgatgatcctgcttatgaaattgagaaaagactttg
gaataagagggttcttataattttagatgatgtggatcatctcaagcaat
tagaaaacttagcaggaggatataattggtttggtgcgggtagtagagtt
atcataacaactagagataaacatctgttaattgctcatggagttagttt
aacatataaggtcaaggaattagaattttgtgaagcttttgagcttttca
gttggaattccttcaaaaaagaccgacctaaggatgactatgtgaaactt
gttgagcgtgctgtctattatacaa
back to top

gene from alignment at AM075224:1..475+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075224.1-BRP16 ID=AM075224.1-BRP16|Name=BRP16|organism=Rosa hybrid cultivar|type=gene|length=475bp|location=Sequence derived from alignment at AM075224:1..475+ (Rosa hybrid cultivar)
gttgccaaagctgtatatgggtcaatcgctcatcgatttgaaggtagctg ttttttggaaaatgtgagagaaaggtcattagtgccacatgaaggcttgg ttcaattgcaagaaactcttctttccaaaattttagggggtgtaggagtg aagctgagcaatgttgatgatcctgcttatgaaattgagaaaagactttg gaataagagggttcttataattttagatgatgtggatcatctcaagcaat tagaaaacttagcaggaggatataattggtttggtgcgggtagtagagtt atcataacaactagagataaacatctgttaattgctcatggagttagttt aacatataaggtcaaggaattagaattttgtgaagcttttgagcttttca gttggaattccttcaaaaaagaccgacctaaggatgactatgtgaaactt gttgagcgtgctgtctattatacaa
back to top