BRP9, AM075217.1-BRP9 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP9
Unique NameAM075217.1-BRP9
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP9BRP9Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP9AM075217.1-BRP9.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075217.1
Alignments
Feature NameTypeLocationAnalysis
AM075217 region AM075217:1..594+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075217.1-BRP9 ID=AM075217.1-BRP9|Name=BRP9|organism=Rosa hybrid cultivar|type=gene|length=594bp
cttgccaaggctatttttaataaacttgttggtcattttgggggacacag
tttcgtctcaaatgttagagaagtctcggcaggacccaagggcttggtat
ctcttcaaaacaaactcatcgcagatctttcccccagtaaggtgcctgtg
aatgaccttgagactggtatttctgcgattaaggcacttgtatgtgatga
gcgagttcttgttgttctggatgatgttgataatgtaaaccaactaagtg
ctttagttggcaaaggacaatggtttaatgaaggaagccgaattatcatt
accacacgagatagaggactattacccagttatcttgtgaattataagtt
gtatgaggtcagggagttggatgtgtcccaggcactacaactgtttagtt
accatgccctgagaagagatagtcccacagataatttcttgagtctgtcc
gagaaaattgtgtctcttacaggtgggctaccgttagctcttgaagtatt
tggttcttttctatgtgataagaggagaatagaggaatggaaagatgctc
tgggcaaactggctaagattcgaccgcaacatcttcaggatgtg
back to top

gene from alignment at AM075217:1..594+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075217.1-BRP9 ID=AM075217.1-BRP9|Name=BRP9|organism=Rosa hybrid cultivar|type=gene|length=594bp|location=Sequence derived from alignment at AM075217:1..594+ (Rosa hybrid cultivar)
cttgccaaggctatttttaataaacttgttggtcattttgggggacacag tttcgtctcaaatgttagagaagtctcggcaggacccaagggcttggtat ctcttcaaaacaaactcatcgcagatctttcccccagtaaggtgcctgtg aatgaccttgagactggtatttctgcgattaaggcacttgtatgtgatga gcgagttcttgttgttctggatgatgttgataatgtaaaccaactaagtg ctttagttggcaaaggacaatggtttaatgaaggaagccgaattatcatt accacacgagatagaggactattacccagttatcttgtgaattataagtt gtatgaggtcagggagttggatgtgtcccaggcactacaactgtttagtt accatgccctgagaagagatagtcccacagataatttcttgagtctgtcc gagaaaattgtgtctcttacaggtgggctaccgttagctcttgaagtatt tggttcttttctatgtgataagaggagaatagaggaatggaaagatgctc tgggcaaactggctaagattcgaccgcaacatcttcaggatgtg
back to top