BRP4, AM075212.1-BRP4 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP4
Unique NameAM075212.1-BRP4
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP4BRP4Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP4AM075212.1-BRP4.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075212.1
Alignments
Feature NameTypeLocationAnalysis
AM075212 region AM075212:1..626+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075212.1-BRP4 ID=AM075212.1-BRP4|Name=BRP4|organism=Rosa hybrid cultivar|type=gene|length=626bp
attgccagggctgtttatgacacaatttctcatcaatttgaacaccgtta
cttccttagagatgtgagggaaggcttcatgaagaaaggtggtgaggtac
ggatgcaacatcaatttctatctggaatcttgaaggtaaacctcaacaat
tttgatgagaattacatgatgatgttgaaaaagttgggtcgggaaaaaat
tctagttgttcttgacgatgtatcccgtcccttggaaattgacgccttac
tcggaagcccaaaggaacgttcatttggttgtggtagtaaagtcattgta
acaactagagatgaacaagtagtaggtggatttaggaaatacaagcccaa
gccattaagtgatcctgacgctcttgaactcttcaaccagaatgccttca
caacaatgccaccctcagaagagtatgatgatctctcaaaacgtgcaatc
aaatatgctcgcggtctgcctttagcacttaaaatcttgggagctcatct
tcgtgacagaagtgcatctgagtgggaatgtgagttggagaaaataaaga
gcatcccaaacccagatattcacgatgtgcttaaaataagctttgatgga
ctagatgcctcccaaaagaacatatt
back to top

gene from alignment at AM075212:1..626+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075212.1-BRP4 ID=AM075212.1-BRP4|Name=BRP4|organism=Rosa hybrid cultivar|type=gene|length=626bp|location=Sequence derived from alignment at AM075212:1..626+ (Rosa hybrid cultivar)
attgccagggctgtttatgacacaatttctcatcaatttgaacaccgtta cttccttagagatgtgagggaaggcttcatgaagaaaggtggtgaggtac ggatgcaacatcaatttctatctggaatcttgaaggtaaacctcaacaat tttgatgagaattacatgatgatgttgaaaaagttgggtcgggaaaaaat tctagttgttcttgacgatgtatcccgtcccttggaaattgacgccttac tcggaagcccaaaggaacgttcatttggttgtggtagtaaagtcattgta acaactagagatgaacaagtagtaggtggatttaggaaatacaagcccaa gccattaagtgatcctgacgctcttgaactcttcaaccagaatgccttca caacaatgccaccctcagaagagtatgatgatctctcaaaacgtgcaatc aaatatgctcgcggtctgcctttagcacttaaaatcttgggagctcatct tcgtgacagaagtgcatctgagtgggaatgtgagttggagaaaataaaga gcatcccaaacccagatattcacgatgtgcttaaaataagctttgatgga ctagatgcctcccaaaagaacatatt
back to top