BRP2, AM075210.1-BRP2 (gene) Rosa hybrid cultivar

Gene Overview
NameBRP2
Unique NameAM075210.1-BRP2
Typegene
OrganismRosa hybrid cultivar ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BRP2BRP2Rosa hybrid cultivargene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
BRP2AM075210.1-BRP2.m1Rosa hybrid cultivarmRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAM075210.1
Alignments
Feature NameTypeLocationAnalysis
AM075210 region AM075210:1..562+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AM075210.1-BRP2 ID=AM075210.1-BRP2|Name=BRP2|organism=Rosa hybrid cultivar|type=gene|length=562bp
gttgccaaagccatctataacaaattttatcatgactttaacagtagaag
tttcctagcagatgttagggaaacagcaaaggacccaagtggtaagattg
cactgcaagaaagacttctttctgatgtcttaaaaccaaccaagatagag
gtaggtgatgtttccaaaggcatcaatgtgatcaaagaacgacttagaag
caaaaaggtacttgtcatcgttgacaatgtcgatcgtctggaacaattga
atgcattcgcaataagccgtgattcctttggtctgggaggtataattatt
ataacaacaagagatcgacatttgttacaacaagtgagagcggataaaat
acatctgacacaagaaatgaatgaagaagaagctcttgagctcttcagtt
ggcatgcctttcaaaattattctcctaaggaagactatatcgaactctca
agaagagtggttacttactgtggaggtttaccgctggctcttgaagtttt
agggtctttcctctttggaaggagcataggagattggaatagcacactga
agaaattggaat
back to top

gene from alignment at AM075210:1..562+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AM075210.1-BRP2 ID=AM075210.1-BRP2|Name=BRP2|organism=Rosa hybrid cultivar|type=gene|length=562bp|location=Sequence derived from alignment at AM075210:1..562+ (Rosa hybrid cultivar)
gttgccaaagccatctataacaaattttatcatgactttaacagtagaag tttcctagcagatgttagggaaacagcaaaggacccaagtggtaagattg cactgcaagaaagacttctttctgatgtcttaaaaccaaccaagatagag gtaggtgatgtttccaaaggcatcaatgtgatcaaagaacgacttagaag caaaaaggtacttgtcatcgttgacaatgtcgatcgtctggaacaattga atgcattcgcaataagccgtgattcctttggtctgggaggtataattatt ataacaacaagagatcgacatttgttacaacaagtgagagcggataaaat acatctgacacaagaaatgaatgaagaagaagctcttgagctcttcagtt ggcatgcctttcaaaattattctcctaaggaagactatatcgaactctca agaagagtggttacttactgtggaggtttaccgctggctcttgaagtttt agggtctttcctctttggaaggagcataggagattggaatagcacactga agaaattggaat
back to top