COX1, AF149038.1-COX1.m1 (mRNA) Prunus dulcis

Transcript Overview
Unique NameAF149038.1-COX1.m1
OrganismPrunus dulcis (Almond)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1AF149038.1-COX1Prunus dulcisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX1COX1Prunus dulcisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF149038.1-COX1.m1-cds1AF149038.1-COX1.m1-cds1Prunus dulcisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
COX1AF149038.1-COX1.p1Prunus dulcispolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF149038 region AF149038:560..673+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productcytochrome c oxidase subunit I
Functioncytochrome c oxidation
Genbank noteRNA editing may cause alteration of start codon
The following sequences are available for this feature:

mRNA sequence

>AF149038.1-COX1.m1 ID=AF149038.1-COX1.m1|Name=COX1|organism=Prunus dulcis|type=mRNA|length=114bp
back to top

protein sequence of COX1

>AF149038.1-COX1.p1 ID=AF149038.1-COX1.p1|Name=COX1|organism=Prunus dulcis|type=polypeptide|length=38bp
back to top

mRNA from alignment at AF149038:560..673+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF149038.1-COX1.m1 ID=AF149038.1-COX1.m1|Name=COX1|organism=Prunus dulcis|type=mRNA|length=114bp|location=Sequence derived from alignment at AF149038:560..673+ (Prunus dulcis)
atgacacgacggctgttctccactaaccacaaggatatagggactctata tttcatcttcggtgctattgctggagtgatgggcacatgcttctcagtat tgattcgtatggaa
back to top

Coding sequence (CDS) from alignment at AF149038:560..673+

>AF149038.1-COX1.m1 ID=AF149038.1-COX1.m1|Name=COX1|organism=Prunus dulcis|type=CDS|length=114bp|location=Sequence derived from alignment at AF149038:560..673+ (Prunus dulcis)
back to top