XET, AJ811689.1-XET (gene) Pyrus communis

Gene Overview
NameXET
Unique NameAJ811689.1-XET
Typegene
OrganismPyrus communis (European Pear)
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
XETXETPyrus communisgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
XETAJ811689.1-XET.m1Pyrus communismRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreAJ811689.1
Alignments
Feature NameTypeLocationAnalysis
AJ811689 region AJ811689:664..1005+ NCBI Rosaceae gene and mRNA sequences
scaffold00807 supercontig scaffold00807:866..1208+ Pyrus communis Genome v1.0 Draft Assembly & Annotation
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AJ811689.1-XET ID=AJ811689.1-XET|Name=XET|organism=Pyrus communis|type=gene|length=342bp
atgaagctctactccagcctgtggaacgcagacgattgggctactcgggg
tggtctggaaaagaccgattggtccaaggccccgttcatcgccagctacc
ggggcttccacatcgacggctgcgaggcctccgtcgaagccaagttttgt
gccacccagggtaagaggtggtgggaccagaaggagttccaagaccttga
tgctcagcaatggaggaggctgaggtgggtccgaaggaaattcaccatct
acaactactgcatgaccgagtcagatacccttctatgccaccggagtgca
agagggacagagacatataaaccaagagtaaattatgattag
back to top

gene from alignment at AJ811689:664..1005+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AJ811689.1-XET ID=AJ811689.1-XET|Name=XET|organism=Pyrus communis|type=gene|length=342bp|location=Sequence derived from alignment at AJ811689:664..1005+ (Pyrus communis)
atgaagctctactccagcctgtggaacgcagacgattgggctactcgggg tggtctggaaaagaccgattggtccaaggccccgttcatcgccagctacc ggggcttccacatcgacggctgcgaggcctccgtcgaagccaagttttgt gccacccagggtaagaggtggtgggaccagaaggagttccaagaccttga tgctcagcaatggaggaggctgaggtgggtccgaaggaaattcaccatct acaactactgcatgaccgagtcagatacccttctatgccaccggagtgca agagggacagagacatataaaccaagagtaaattatgattag
back to top