CWINV, AF000520.1-CWINV.m1 (mRNA) Fragaria x ananassa

Transcript Overview
Unique NameAF000520.1-CWINV.m1
OrganismFragaria x ananassa (Strawberry)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CWINVCWINVFragaria x ananassagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF000520.1-CWINV.m1-cds1AF000520.1-CWINV.m1-cds1Fragaria x ananassaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CWINVAF000520.1-CWINV.p1Fragaria x ananassapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF000520 region AF000520:1..1215+ NCBI Rosaceae gene and mRNA sequences
LG4 chromosome LG4:23090886..23093429- Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Productcell wall invertase
Functionsucrose hydrolysis
The following sequences are available for this feature:

mRNA sequence

>AF000520.1-CWINV.m1 ID=AF000520.1-CWINV.m1|Name=CWINV|organism=Fragaria x ananassa|type=mRNA|length=1215bp
back to top

protein sequence of CWINV

>AF000520.1-CWINV.p1 ID=AF000520.1-CWINV.p1|Name=CWINV|organism=Fragaria x ananassa|type=polypeptide|length=404bp
back to top

mRNA from alignment at AF000520:1..1215+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF000520.1-CWINV.m1 ID=AF000520.1-CWINV.m1|Name=CWINV|organism=Fragaria x ananassa|type=mRNA|length=1215bp|location=Sequence derived from alignment at AF000520:1..1215+ (Fragaria x ananassa)
atggctccaactcaagctaaccaaatcaatgccagctcatttagggatcc taccactgcttggctagggccagataagagatggaggttgatcattggaa gcaaaaggagccaaaggggactagctatcctctacagaagcaaagatttc atgcattggactaaggctaaacatccattatattcaacaccgaaaaatgg tatgtgggaatgccctgattttttcccagtttcgaagactaagttgcttg gtcttgacacatctgcaattggtccggatgttaagcatgtactcaaagtt agcttggacaacactaggaaagagtactacacaattggtacatataatgt gagcaaggatatctatatcccagatgatggatcaattgagagtgattctg gtttgagatatgattatggtaagttttatgcttcaaaaaccttctttgac agtgctaagaaccgcagaatcttgtggggttggatcaatgagtcctcaag tgttagtggtgacatcaagaaaggatggtctggactccaggcaattccaa ggactattgtgctcgacaaatctggaaagcaattggtgcaatggcctgta gtagagcttgagaaacttagaacaaacgaggtcaagttaccaagcactct ccttaaaggaggatcacttcatgaagtcattggtgtcacagcagcacagg ctgatgtagatgttgcatttgagataagtgatctcaagaaagcagaagtt atggatccaagttggactaatgcacaacttttgtgtagtaaaaagggtac ctcagtgaaaggggctctaggaccatttggattgttggcatttgtttcaa aggatttgaaagaaaagacagcaatcttctatagaattttcaagtctcac aacaataacaacaaatatgtggttcttatgtgcagtgagcaaagcagatc ttccctaaacccagataatgatatgacaacttacggagtatttgtaaatg tggatcctcttcatgaaaagctgtcattaagaagtttgattgatcactct atagtggagagttttggtggaaaaggcaaggcgtgcataacagctagggt gtatcctacaatgactgttgatggtgatacccatttatatgcattcaatt atggaagtgagagtgtcaaaatcgcaggaagtgcatggagcatgaaaact gctcaaatcaattga
back to top

Coding sequence (CDS) from alignment at AF000520:1..1215+

>AF000520.1-CWINV.m1 ID=AF000520.1-CWINV.m1|Name=CWINV|organism=Fragaria x ananassa|type=CDS|length=1215bp|location=Sequence derived from alignment at AF000520:1..1215+ (Fragaria x ananassa)
back to top