ACO, AF026793.1-ACO.m1 (mRNA) Prunus armeniaca

Transcript Overview
Unique NameAF026793.1-ACO.m1
OrganismPrunus armeniaca (Apricot)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACOACOPrunus armeniacagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF026793.1-ACO.m1-cds1AF026793.1-ACO.m1-cds1Prunus armeniacaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACOAF026793.1-ACO.p1Prunus armeniacapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF026793 region AF026793:80..1039+ NCBI Rosaceae gene and mRNA sequences
scaffold_3 supercontig scaffold_3:16205609..16206881- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Product1-aminocyclopropane-1-carboxylate oxidase
Genbank noteACC oxidase
The following sequences are available for this feature:

mRNA sequence

>AF026793.1-ACO.m1 ID=AF026793.1-ACO.m1|Name=ACO|organism=Prunus armeniaca|type=mRNA|length=960bp
back to top

protein sequence of ACO

>AF026793.1-ACO.p1 ID=AF026793.1-ACO.p1|Name=ACO|organism=Prunus armeniaca|type=polypeptide|length=319bp
back to top

mRNA from alignment at AF026793:80..1039+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF026793.1-ACO.m1 ID=AF026793.1-ACO.m1|Name=ACO|organism=Prunus armeniaca|type=mRNA|length=960bp|location=Sequence derived from alignment at AF026793:80..1039+ (Prunus armeniaca)
atggagaacttcccaatcatcaacttggagggcctcaatggagagggaag gaaagcaacaatggaaaaaatcaaagatgcgtgtgagaattggggcttct ttgagcttgtgagtcatgggataccaactgagtttttggacacagtggag aggttgactaaagaacactacaggcagtgcttggagcagaggttcaagga gctggtggccagcaagggccttgaggctgtcaagacagaggtcaatgata tggactgggaaagcaccttctacttgcgccatcttccaaaatctaacata tctgaagttccagatcttgaggatcagtacaggaatgtgatgaaggaatt tgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg agaatcttggacttgaacaagggtacctcaagaaggccttctatggaaca aatggaccaacttttggcaccaaggttagcaactaccctccttgtcccaa ccctgagctgatcaagggtctccgggctcacaccgatgccggcggcctca tcctgctcttccaggatgacaaggtcagtggtctgcagctcctcaaggat ggccaatggattgatgtgccccccatgcgccactccattgttatcaacct tggtgaccaacttgaggtgatcactaacgggaagtacaagagcgtggagc acagagtgattgcccaaactgatggcaccagaatgtcaatagcttccttc tacaaccctggcagtgatgctgtcatctaccctgcaccaacactggtgga gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaag actacatgaagctctatgctggcctcaagttccagcccaaagagccaaga tttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgc aacagcttaa
back to top

Coding sequence (CDS) from alignment at AF026793:80..1039+

>AF026793.1-ACO.m1 ID=AF026793.1-ACO.m1|Name=ACO|organism=Prunus armeniaca|type=CDS|length=960bp|location=Sequence derived from alignment at AF026793:80..1039+ (Prunus armeniaca)
back to top