S34-RNase, DQ224345.1-S34-RNase (gene) Pyrus pyrifolia

Gene Overview
NameS34-RNase
Unique NameDQ224345.1-S34-RNase
Typegene
OrganismPyrus pyrifolia ()
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S34-RNaseS34-RNasePyrus pyrifoliagene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
S34-RNaseDQ224345.1-S34-RNase.m1Pyrus pyrifoliamRNA


Cross References
External references for this gene
DatabaseAccession
nuccoreDQ224345.1
Alignments
Feature NameTypeLocationAnalysis
DQ224345 region DQ224345:1..428+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>DQ224345.1-S34-RNase ID=DQ224345.1-S34-RNase|Name=S34-RNase|organism=Pyrus pyrifolia|type=gene|length=428bp
tttacgcagcaatatcagccggctgtctgcaactctaaccctactccttg
taaggattctccagacaagttgtttacggttcacggcttgtggccttcaa
actcgagtggacctcacccacataattgcacgaatacaaccgtgaaatct
cagacggtaatattattgataatcagatattgttagattagtcattgacg
gggtttgaacccacgtcatcatgcaaagtttcaacatctttccgcgactg
tagtaaagagctacttgcttatttcatatatacatatactcaacatagat
tttcatgcaagagtgtgcaaatattacaattaatttaaaatttaatcata
attatttttctcttatttatattatattgtcagataagatcactcaaagc
ccagttggaaattatttggccgaacgta
back to top

gene from alignment at DQ224345:1..428+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ224345.1-S34-RNase ID=DQ224345.1-S34-RNase|Name=S34-RNase|organism=Pyrus pyrifolia|type=gene|length=428bp|location=Sequence derived from alignment at DQ224345:1..428+ (Pyrus pyrifolia)
tttacgcagcaatatcagccggctgtctgcaactctaaccctactccttg taaggattctccagacaagttgtttacggttcacggcttgtggccttcaa actcgagtggacctcacccacataattgcacgaatacaaccgtgaaatct cagacggtaatattattgataatcagatattgttagattagtcattgacg gggtttgaacccacgtcatcatgcaaagtttcaacatctttccgcgactg tagtaaagagctacttgcttatttcatatatacatatactcaacatagat tttcatgcaagagtgtgcaaatattacaattaatttaaaatttaatcata attatttttctcttatttatattatattgtcagataagatcactcaaagc ccagttggaaattatttggccgaacgta
back to top