LFY, AF487196.1-LFY.m1 (mRNA) Neillia hanceana

Transcript Overview
Unique NameAF487196.1-LFY.m1
OrganismNeillia hanceana ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAF487196.1-LFYNeillia hanceanagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYNeillia hanceanagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF487196.1-LFY.m1-cds1AF487196.1-LFY.m1-cds1Neillia hanceanaCDS
AF487196.1-LFY.m1-cds2AF487196.1-LFY.m1-cds2Neillia hanceanaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAF487196.1-LFY.p1Neillia hanceanapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF487196 region AF487196:1..638+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>AF487196.1-LFY.m1 ID=AF487196.1-LFY.m1|Name=LFY|organism=Neillia hanceana|type=mRNA|length=57bp
back to top

protein sequence of LFY

>AF487196.1-LFY.p1 ID=AF487196.1-LFY.p1|Name=LFY|organism=Neillia hanceana|type=polypeptide|length=18bp
back to top

mRNA from alignment at AF487196:1..638+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487196.1-LFY.m1 ID=AF487196.1-LFY.m1|Name=LFY|organism=Neillia hanceana|type=mRNA|length=638bp|location=Sequence derived from alignment at AF487196:1..638+ (Neillia hanceana)
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtt tttacaaacgctaatttctaccgtggtaaatacttcgtcatttacaacct gatcgttgtgggcccatcgttggctagtggcccgcaattggagaggcatg ctggcacgttcaatataaatgttcgaactataaatctaggaataattaat agtttgttactaaattaggaactttgggttcatttacaaacacttttatt aaaagcacaacaaaaaggaagtgcatctccaacaaccataaaaaatactt ttagagtaaaaaatcacttttaattatttcaaccatgggtcaagaccaaa tgttgatccactaataattaatcgtgttcttctctttcatagtaaaaaac acttgcactattttgtaggataaaaatctagactcaattgttggtgcaga cgacttctattgtgtacggtgaatgttttatgttttcttctataatttga aatgttttttgtttttttttcctaacattaacaactgtcgtaagtactaa ttgtgcattatgtataattggacggattaagcagcttacttattatatat gcaggtgacaaaccaggtgtttaggtatgccaaaaagg
back to top

Coding sequence (CDS) from alignment at AF487196:1..638+

>AF487196.1-LFY.m1 ID=AF487196.1-LFY.m1|Name=LFY|organism=Neillia hanceana|type=CDS|length=57bp|location=Sequence derived from alignment at AF487196:1..638+ (Neillia hanceana)
back to top