LFY, AF487175.1-LFY.m1 (mRNA) Neillia affinis

Transcript Overview
NameLFY
Unique NameAF487175.1-LFY.m1
TypemRNA
OrganismNeillia affinis ()
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAF487175.1-LFYNeillia affinisgene


This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYNeillia affinisgene


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF487175.1-LFY.m1-cds1AF487175.1-LFY.m1-cds1Neillia affinisCDS
AF487175.1-LFY.m1-cds2AF487175.1-LFY.m1-cds2Neillia affinisCDS


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAF487175.1-LFY.p1Neillia affinispolypeptide


Cross References
External references for this mRNA
DatabaseAccession
GI19908935
nuccoreAF487175.1
Alignments
Feature NameTypeLocationAnalysis
AF487175 region AF487175:1..679+ NCBI Rosaceae gene and mRNA sequences
Properties
Property NameValue
ProductLEAFY protein
Sourcegenbank
Sequences
The following sequences are available for this feature:

mRNA sequence

>AF487175.1-LFY.m1 ID=AF487175.1-LFY.m1|Name=LFY|organism=Neillia affinis|type=mRNA|length=57bp
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcc
aaaaagg
back to top

protein sequence of LFY

>AF487175.1-LFY.p1 ID=AF487175.1-LFY.p1|Name=LFY|organism=Neillia affinis|type=polypeptide|length=18bp
GEKCPTKVTNQVFRYAKK
back to top

mRNA from alignment at AF487175:1..679+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487175.1-LFY.m1 ID=AF487175.1-LFY.m1|Name=LFY|organism=Neillia affinis|type=mRNA|length=679bp|location=Sequence derived from alignment at AF487175:1..679+ (Neillia affinis)
gcggtgagaaatgtcccaccaaggtacggagttacacccctccctacgtt tttacaaacgctaatttctaccgcggtaaatacttcgtcatttacaacct gctcgttgtgggcccatcgttggctagtgggccgcaattggagaagcatg ctgacacgttcaatataaatgttcaaactaaatctaggagcccaagttca caagaaataaaatcattaatagtgtgttgctaaattaggaactttgggtt cgtttggtattacttctatggaaacacttttattaaaagcacaacaaaaa ggaagtgcatctccaacaaccataaaaaatacttttagagtacaaaatca cttttaattatttcaaccatgggtcaagaccaaatgttgacccactaata attaatcgtgttcttctctttcatagtaaaaaacacttgcactattttgt aggataaaaatctagacacaattgttggtgcagagtgcagacgacttcta ttgtgtacggtgaatgttttatgttttcttctataatttgaaatgttttt tgttttttttttctaacattaacaactgtcgtaagtactaattgtgcatt atgtataattggacggattaagcagcttacttattatatatgcaggtgac aaaccaggtgtttaggtatgccaaaaagg
back to top

Coding sequence (CDS) from alignment at AF487175:1..679+

>AF487175.1-LFY.m1 ID=AF487175.1-LFY.m1|Name=LFY|organism=Neillia affinis|type=CDS|length=57bp|location=Sequence derived from alignment at AF487175:1..679+ (Neillia affinis)
gcggtgagaaatgtcccaccaaggtgacaaaccaggtgtttaggtatgcc
aaaaagg
back to top