LFY, AF487164.1-LFY.m1 (mRNA) Kageneckia oblonga

Transcript Overview
Unique NameAF487164.1-LFY.m1
OrganismKageneckia oblonga ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAF487164.1-LFYKageneckia oblongagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYKageneckia oblongagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF487164.1-LFY.m1-cds1AF487164.1-LFY.m1-cds1Kageneckia oblongaCDS
AF487164.1-LFY.m1-cds2AF487164.1-LFY.m1-cds2Kageneckia oblongaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAF487164.1-LFY.p1Kageneckia oblongapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF487164 region AF487164:1..698+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>AF487164.1-LFY.m1 ID=AF487164.1-LFY.m1|Name=LFY|organism=Kageneckia oblonga|type=mRNA|length=174bp
back to top

protein sequence of LFY

>AF487164.1-LFY.p1 ID=AF487164.1-LFY.p1|Name=LFY|organism=Kageneckia oblonga|type=polypeptide|length=58bp
back to top

mRNA from alignment at AF487164:1..698+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487164.1-LFY.m1 ID=AF487164.1-LFY.m1|Name=LFY|organism=Kageneckia oblonga|type=mRNA|length=698bp|location=Sequence derived from alignment at AF487164:1..698+ (Kageneckia oblonga)
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacga gcaatgccgcgatttcttgatccaggtccagaacattgccaaggagcgcg gtgaaaaatctcccaccaaggtatgaagttttacccatcttcccttttac ctgatttctactgttgtaattatcagtaaattcatcattgagtcattgat cgctgtgggctcatttcctctagtacaattggagggcctgctactcacgg catctatataaatttcagttgggttataggttctcgaatcgaacacaaat ctttcttttttttaataatcaaactaaatacaaatattaaattgtcacgt tcataatagtttcgttcatgtactgcaagttgcatcgacattggtcccta caatttgcaaattactgaattttgaggtcacccgtcaaattttgttgaat ccttgtatgaactccgttaaatttaccctttcgtgtaccacgtacataac gatttggtacaagccaaggaattaatggaagttggggttcagggatgccc tcgagttggaacaatttgcaatctacatgaactaaaaccgtgttgggggt aaatatcgttttacatttgtttactctacacgttaaatatgcaggtgaca aaccaagtgtttaggtatgccaaaaaggcaggggcaagctacatcaac
back to top

Coding sequence (CDS) from alignment at AF487164:1..698+

>AF487164.1-LFY.m1 ID=AF487164.1-LFY.m1|Name=LFY|organism=Kageneckia oblonga|type=CDS|length=174bp|location=Sequence derived from alignment at AF487164:1..698+ (Kageneckia oblonga)
back to top