LFY, AF487162.1-LFY.m1 (mRNA) Lyonothamnus floribundus

Transcript Overview
Unique NameAF487162.1-LFY.m1
OrganismLyonothamnus floribundus ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYAF487162.1-LFYLyonothamnus floribundusgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
LFYLFYLyonothamnus floribundusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AF487162.1-LFY.m1-cds1AF487162.1-LFY.m1-cds1Lyonothamnus floribundusCDS
AF487162.1-LFY.m1-cds2AF487162.1-LFY.m1-cds2Lyonothamnus floribundusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
LFYAF487162.1-LFY.p1Lyonothamnus floribunduspolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
AF487162 region AF487162:1..659+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
ProductLEAFY protein
The following sequences are available for this feature:

mRNA sequence

>AF487162.1-LFY.m1 ID=AF487162.1-LFY.m1|Name=LFY|organism=Lyonothamnus floribundus|type=mRNA|length=174bp
back to top

protein sequence of LFY

>AF487162.1-LFY.p1 ID=AF487162.1-LFY.p1|Name=LFY|organism=Lyonothamnus floribundus|type=polypeptide|length=58bp
back to top

mRNA from alignment at AF487162:1..659+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF487162.1-LFY.m1 ID=AF487162.1-LFY.m1|Name=LFY|organism=Lyonothamnus floribundus|type=mRNA|length=659bp|location=Sequence derived from alignment at AF487162:1..659+ (Lyonothamnus floribundus)
gtggcacgtggcaaaaagaacggcctcgattacctcttccatctctacga gctgtgccgtgatttcttgatccaggtccagaacattgccaaggagcgcg gtgaaaaatgtcccaccaaggtacggattatttacccacctcccttcatc atcacatacgctgatttctactgtggtaaacagtaaaaaataaccacaaa ataatgagatcaataaactatgatgttagttagcaaaaaaaaatacaatt attataggcatgtgggcctagtattttagttggagaggcctgctgacagc atcaataactccgggccggatctaaatctatcattgggtatgaggcagag caactgcacaagaaaaacaaaatcataactaggtttatgtcacaagatta gtttttaatccagctttaatcttaatttgatttgactatagtcagatgta gatgtcgagttcaaccgcggattcgattacgatgtaataactgttaatca aatgcaaatgcgatgataatctgacccgatttaacaaaatgtagaattca ttttccgttgtactcagtgaaattgtggttaatgtagtgaacattgtgta tataggtgacaaaccaagtgtttaggcatgctaaaaaggcaggcgcaagc tacatcaac
back to top

Coding sequence (CDS) from alignment at AF487162:1..659+

>AF487162.1-LFY.m1 ID=AF487162.1-LFY.m1|Name=LFY|organism=Lyonothamnus floribundus|type=CDS|length=174bp|location=Sequence derived from alignment at AF487162:1..659+ (Lyonothamnus floribundus)
back to top