CRY1, GQ497942.1-CRY1.m1 (mRNA) Fragaria vesca

Transcript Overview
Unique NameGQ497942.1-CRY1.m1
OrganismFragaria vesca (Woodland strawberry (diploid))
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CRY1CRY1Fragaria vescagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
GQ497942.1-CRY1.m1-cds1GQ497942.1-CRY1.m1-cds1Fragaria vescaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CRY1GQ497942.1-CRY1.p1Fragaria vescapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
GQ497942 region GQ497942:1..2022+ NCBI Rosaceae gene and mRNA sequences
LG5 chromosome LG5:27617864..27621219+ Fragaria vesca Whole Genome v1.0 (build 8) Assembly & Annotation
Property NameValue
Genbank noteblue light photoreceptor; FvCRY1
The following sequences are available for this feature:

mRNA sequence

>GQ497942.1-CRY1.m1 ID=GQ497942.1-CRY1.m1|Name=CRY1|organism=Fragaria vesca|type=mRNA|length=2022bp
back to top

protein sequence of CRY1

>GQ497942.1-CRY1.p1 ID=GQ497942.1-CRY1.p1|Name=CRY1|organism=Fragaria vesca|type=polypeptide|length=673bp
back to top

mRNA from alignment at GQ497942:1..2022+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>GQ497942.1-CRY1.m1 ID=GQ497942.1-CRY1.m1|Name=CRY1|organism=Fragaria vesca|type=mRNA|length=2022bp|location=Sequence derived from alignment at GQ497942:1..2022+ (Fragaria vesca)
atgtcaggtggtagtggttgcagtgtagtttggttcaggagagatctgag ggttgaagacaatccagctttgttagctggagttagagcaggaggagttg ttgctctttttatttgggcacctgaggaagaagggccttattacccagga agggtctcaaggtggtggctcaaacacagtttggcacatcttgattcctc tttgagaagtttgggcactcctctcatcaccaaaaaatctactgacagtg tttcttctcttcttgaggtttgtcttgcaactggagccactcagctcttc ttcaaccacttatatgatcctatatcactggttagagatcacagggccaa ggaggttttgtccgccaacggcataactgtgcgttcctttaacgccgatt tgctctatgaaccatgggatgttaatgatgtccacggtcgtccattcaca acctttgatgctttttgggaaagatgcctcagcatgccctttgatccaga ggcaccacttctcccccctaagagaatcatatcaggtgatgcatcaaggt gtcctcctgatacattggtttttgaagatgaatcagagaagggaagcaat gcgctacttgctcgagcatggtcacctgggtggagcagtgctgataaggc agtaaccacatttattaatggtccattgatcgagtattccacaaaccgca gaaaggctgatagtaatacaacttcactgctttctccccatttgcatttt ggggaggtaagtgtcagaaaagtatttcatcttatacgcatcaagcagtt gctttgggccaatgaaggtaacaaggctggtgaagagagtgtgaacttgt ttctgaaatctattggtcttagggagtattcaagatacattagtttcaat catccttacagtcatgaaagacctcttcttgggcacctaaaattcttccc ctgggttataaatcagaactatttcaaggcatggaggcaaggtcgaactg gctatccgttggtggatgctggcatgagagaattgtgggctactggctgg ctgcatgatcggatacgagttgttgtttctagtttcttcgtaaaggttct gcagctcccgtggaggtggggaatgaagtatttctgggacacactcttag atgctgatcttgaaagtgatgctcttggttggcagtatatatccggcact atccctgatgggcgtgagtttgaccgcatagataatccacagtttgaggg ttacaagtgtgatccacatggagaatatgtgcgaaggtggcttcctgaac tatccaggctaccaactgactggatacaccacccatggaatgcaccagag tctgtactccaggcagctggaattgaacttggatcaaattacccccttcc tattgtaggaatagaagcagcaaaatccaggttgcaagaagcgttaactg aaatgtggcagcatgaacgagccgctgctgagaatggaactgaagaaggg ctcggagagtcttctgaatcaacctccattgcgtttcctgaagacataca aatggaggatagtcatgaacaggtgaggaataaccctcctcctccaactc gacgctatgaggatcagatggtccctagtatcactacttccctcgtgcga gttgaagaggaagaaagttctttggatcttccaagcagagctgaagtgcc tacaaatgttactggggatcaagaaccaatgagagacacaatgaaccaag agggttttcagcctaatcataacaacactccaccacaacctaatactaca ctaaccctgcagtatgttgttgaagattcgacggcggaatcgtctagcag tactaggagagagagggatggaggtgtagttccagtttggtctccttcaa attctagctactcagagcagtttgtgagtgatgaaaatggcattgcaaca agttcttacttgcagagacatcctcagtctcaccaaataatgaattggag gcggctatctcaaactgggtaa
back to top

Coding sequence (CDS) from alignment at GQ497942:1..2022+

>GQ497942.1-CRY1.m1 ID=GQ497942.1-CRY1.m1|Name=CRY1|organism=Fragaria vesca|type=CDS|length=2022bp|location=Sequence derived from alignment at GQ497942:1..2022+ (Fragaria vesca)
back to top